The diagrams below show very simplified species relationships for certain areas of African savanna.Recall what the direction of arrows means for each type of diagram. Then use these simplifieddiagrams to answer the next 3 questions. (Note: Real-world savannas support more species with morecomplex relationships.)ElephantsTreesTreesSavanna Food WebLionsZebraShrubsCompetition Among Savanna PlantsShrubsCheetahsGazelleGrassesGrassesQ5.6. If you removed all the Lions from a large area of savanna, which of the following is aDIRECT effect that could be explained by the diagrams? Q5.6. If you removed all the Lions from a large area of savanna, which of the following is aDIRECT effect that could be explained by the diagrams?OооAn increase in the Cheetah population sizeA decrease in the Cheetah population sizeAn increase in the Gazelle population sizeA decrease in the Gazelle population sizeSubmit

The correct answer is option c. An increase in Gazelle population size.

grams to answer the next 3 questions. (Note: Real-world savannas support more species with r mplex relationships.) Elephants Trees Trees Savanna Food Web Lions Zebra Shrubs Competition Among Savanna Plants Shrubs Cheetahs Gazelle Grasses Grasses 5.6. If you removed all the Lions from a large area of savanna, which of the following RECT effect that could be explained by the diagrams?

grams to answer the next 3 questions. (Note: Real-world savannas support more species with r mplex relationships.) Elephants Trees Trees Savanna Food Web Lions Zebra Shrubs Competition Among Savanna Plants Shrubs Cheetahs Gazelle Grasses Grasses 5.6. If you removed all the Lions from a large area of savanna, which of the following RECT effect that could be explained by the diagrams?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter1: Invitation To Biology

Section: Chapter Questions

Problem 1FIO: Figure 1.7 Taxonomic classification of five species that are related at different levels. Each...

See similar textbooks

Similar questions

Based on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂
on izzes - GENERAL BIOLOGY I X D2L Biodiversity - GENERAL BIOLOG × G Plant-liked protists are usually.. X + Ims/quizzing/user/attempt/quiz_start_frame_auto.d2l?ou=192364&isprv=&qi=350833&cfql=0&dnb=0&fromQB=0&inProgress 3 6 ✓ 9 Question 8 (7.5 points) Listen Organisms in which of the following groups would you expect to not be saprotrophic? Archaea Fungi Animalia Plantae Eubacteria Question 9 (7.5 points) ✓ Saved Listen Mushrooms are a type of structure. digestive respiratory feeding predatory reproductive Search acer A S P 1 R E པ
es ne Based on the information in the following table, and the given phylogenetic tree, what kind of species classification is shown? A B C D E F G H I J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L Pits (P) or Tubercles (T) P P T T T T T P P P P P P P P Form of dorsal ridges M₁ M₁ M₂ M₂ M₂ M₂ M₂ M3 M3 M3 M3 M3 M4 M3 M3
From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 O 7 2 3 4 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT E Species Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 5 6 7
Drawing of organism: Domain: Kingdom: Division/Phylum: bsovnos brs wollod (mo01 od ot wollsy suer toos ons Genus: Species: Distinguishing features: nd isb seaUsz to elmetsioleeim possesses Common name: Scientific name: Drawing of organism: Domain: Kingdom: onntiv of chiorophyll pigts Division/Phylum: hich inay or may not incude cond or ovetho which are thick.cylindrical, and spongy, dar'sgro Codium fregile (dead man's Genus: Species: Distinguishing features: Common name: bau2 b Scientific name:
Choose correct answers Females of Spongy Moth (Lymantria dispar dispar) have no wings. Spongy Moth is a native species. | Both Spongy Moth and Satin Moth belong to the same subfamily. Eastern Spruce Budworm (Choristoneura fumiferana) feed on both fir and spruce. Eastern Spruce Budworm is an introduced species.
Based on your analysis of the following graph and accompanying cladogram (species have been assigned letters A, B, C, D, E, and F), Which of the following statements is TRUE? A В с D F -20 -15 -10 10 15 Average winter temperature (°C) Phylogeny of species Fur thickness in all 6 of these closely related species is most likely a result of Phylogenetic Affinity, and does NOT suggest an adaptation to differences in Average Winter temperature Fur thickness in the subgroup of species "A", "B" and "C" are most likely a result of Phylogenetic Affinity, and does NOT suggest an adaptation to differences in Average Winter temperature Fur thickness in the subgroup of species "D", "E" and "F" are most likely a result of Phylogenetic Affinity, and does NOT suggest an adaptation to differences in Average Winter temperature Fur thickness in the subgroup of species "A", "B" and "C" are most likely a result of Physiological Convergence. Similarity in fur thickness between species "A" and "D", and…
A. Basic Phylogenetic Tree Construction: Create a phylogenetic tree which best represent the data provided: Species Enzyme 1 Enzyme 2 Enzyme 3 Enzyme 4 Guinca pir present present albsent present Camel alosent absent present absent Capvbara prescnt present absent present Species Enzyme 1 Enzyme 2 Enzyne 3 Enzyme 4 Opusurn present presenl pnesent present Plalypus ppresent present pnesent alsennt Chit ken prment atrent ataent atrsent B. Encircle Monophyletic groups that can be found in this tree. Angus cattle White-tailed deer Blue whale Pygmy hippopotamus Extinct Wild boar Mammal Alpaca Based on the phylogenetic tree above, what species is most related to the blue whale?
UNITED ISD USHS 9th Bio Midterm Highlighter X Researchers analyzed a mitochondrial gene of different bat species to determine relatedness. A cladogram of their results is shown. A Ptenochirus minor and Megaerops niphanae (C) Based on the cladogram, which set of bat species is the least related? Cynopterus sphinx Haplonycteris fischeri Dyacopterus spadiceus Chironax melanocephalus Hanlonvcteris fischerl and Ptenochirus iagori Clear Otopteropus cartilagonodus Ptenochirus jagori Ptenochirus minor B Dyacopterus spadiceus and Otopteropus cartilagonodus Megaerops niphanae DELL
Using Online Interactive Guides to Identify Philippines Ants Look for the common ants that you can find in your backyard. What we are going to do is we will try to identify some of these endemic ants that were only recorded in the Philippines using an online interactive guide. What you need are just your access to Internet and your sharp minds. 1. On your search engines, type http://www.discoverlife.org/mp/20q 2. On the “insects” category where Ants is a subcategory, click Ants Philippines. 3. Answer one or more questions found on the rightmost side by clicking the appropriate checkboxes. It is allowed to check multiple boxes. Then, click the “search” button. 4. Give the 18 scientific names of the ants you collected.
с C C Blue Oak (B) Oregon Oak (0) Valley Oak (V) Coast Live Oak (C) Which character(s) in the data matrix are parsimony informative? B B B Tree 1 X X B 1 A T T T T T B B 2 A A 2, 4, and 6 3 Tree 2 তত ত Use the diagrams below to: Draw the three possible unrooted trees for the four taxa in the data matrix. Map each informative character, correctly showing the changes on each tree. Circle the most parsimonious tree Please draw out your response to questions 2-4 using the template below as a guide, take a picture, and list the correct number of steps and then insert the picture below. G с G 4CCG G с G G SATIG 5 6 G 5559 G B B C X X X G C B Tree 3 X
Cladograms are diagrams that show relationships among organisms based on derived traits. The table below shows a set of derived traits for five different species of land plants. Carolina Quillwort Species French Rose Palm Moss Giant Sequoia A D Vascular Tissue 11 + W + + al 11 Derived Traits (+ indicates character is present) Carpels Woody Tissue Royal Fern A table that shows derived traits in various land plant species. Seeds + tionary relationships among the five land plants? Press the arrows + + B Based on the information in the table above, which of the following cladograms best represents the evolu- + S + Stamens Megaphylls + с + 2 + to expand the cladograms. 11. + #1