Q: Consider two proteins, A and B, that can interact with a Kg = 2.55 nM. If you mix the two proteins s...
A: Option A is the answer. Given,Kd = 2.55nM Kd = [A][B]/[AB] = 2.55
Q: 2 3 4 In the above figure, black and pink lines represent nonhomologous chromosomes. Which of the fi...
A: Gametes They are the reproductive units which combines together to produce zygote.
Q: Long-term prenatal care is often associated with more offspring. O True False
A: Prenatal care is the point at which you get tests from a specialist, medical attendant, or birthing ...
Q: explain how DNA indirectly regulates the synthesis ofnonprotein molecules.
A: DNA or deoxyribonucleic acid is the primary molecule for storing genetic information in living organ...
Q: amino acid sequences for cytochrome c why is monkey the most closely related organism to humans? Bas...
A: Cytochrome c (Cyt c) is a protein that is most commonly found in higher organisms and thus, it is em...
Q: Hi I need the answer to this question please
A: In Daphne Island, the original population of finches have different types of beak sizes according to...
Q: You are a science teacher and you observed that two students in your class are showing signs of chic...
A: The varicella-zoster virus is responsible for chickenpox. It produces a rash of thin, fluid-filled b...
Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?...
A: The process of synthesis of proteins is called translation. Proteins are synthesised in a cell in th...
Q: Discuss the common fomites or transmission factors involved in MRSA
A: Methicillin-resistant Staphylococcus aureus is a bacterium that causes infections in various parts o...
Q: Describe phenotypic changes that occurred in plant populations as a result of human selection
A: Human selection means Artificial selection or selective breeding. In which humans select the desirab...
Q: Describe the components of the hypothalamic-pituitaryadrenocortical axis, and explain how it regulat...
A: The hormones are known to be the biological regulators of the body. They have secreted from the duct...
Q: Emma was called in for an emergency laparotomy and possible splenectomy for blunt force trauma late ...
A: According to bartleby expert guidelines when multiple subpart questions are posted we are allowed to...
Q: Describe the structure and function of a neuron.
A: Nervous system of an organism is aimed at maintaining control and coordination. The basic unit of ne...
Q: procedure/s in performing aseptic transfer of bacterial cultures in (include illustration) (3) agar ...
A: Aseptic Technique describe some of the ways that a laboratory can deal with the constant threat of m...
Q: Describe how pregnancy tests work. What hormone are they looking for, and what effect does it have?
A: Answer: PREGNANCY : It is the condition in females where the egg (female gamete) is fertilized by t...
Q: Water behind a dam has a certain amount of stored energy that can be released as the water falls ove...
A: Answer: Kinetic energy is the energy of motion, observable as the movement of an object, particle, ...
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start ...
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary a...
Q: Describe the endomembrane system of the cell and its role in the transport of important molecules
A: Answer: CELL : A cell is the structural and functional unit of life, where it performs many processe...
Q: While camping you notice a “Do Not Litter” sign nailed onto the trunk of a mature oak tree about 7 f...
A: The trunk and the branches of the tree are always thicker as compared to other parts of the tree. Th...
Q: As light intensity and carbon dioxide concentration increase, the rate of photosynthesis initially C...
A: Photosynthesis: It is process of producing energy in organism like plants for metabolic processes. T...
Q: Succession occurs in natural ecosystems. Describe and explain how succession occurs.
A: ECOLOGICAL SUCCESSION It is the process of change in the species structure of an ecological communi...
Q: Explain Ganglion Cell Receptive Fields?
A: Introduction: Retinal Ganglion Cells (RGC) is a kind of neuron that is found in the retina of the ey...
Q: Match the following characteristics to either (a) autotrophsor (b) chemoheterotrophs:Many microorgan...
A: Microorganisms are ubiquitous, and they are abundant in nature. They are involved in maintaining the...
Q: What is a calorie? Select one: The amount of energy required to raise 1.0 Kilogram of water 1.0 deg...
A: NOTE: AS PER OUR GUIDELINES WE ARE ONLY SUPPOSED TO ANSWER THE FIRST THREE QUESTIONS, PLEASE RESUBMI...
Q: 1. The table below shows partial diploid E. coli with lac operon mutations For each mutant, indicate...
A: Mutation in promoter or operator is cis sort, which implies their performance cannot be supplemented...
Q: Which animal phyla have bilateral symmetry? Group of answer choices ;Select ALL that apply: Ch...
A: Answer:- Bilateral symmetry means organisms that have body shapes that are mirror images These mirro...
Q: If the amino acid sequences of monkeys and humans in the protein of two organisms are similar, why w...
A: Amino acids Amino Acids are known as building blocks of proteins. There are many different kind of ...
Q: DNA replication occurs in the: ‘5 to 3’ direction/ 3’ to 5’ direction? (Circle your answer)
A: DNA replication: DNA replication is a biological process in which double stranded DNA molecule copie...
Q: what is the pharmacological category of Hydroxyprogesterone?
A: Stetoid hormones are produced in the body mainly by the adrenal gland and liver .
Q: Which of the following describes Gene Expression? O Take a Genetic Code and turn it into Proteins O ...
A: Ans- Gene Expression is a) Take a Genetic code and turn it into Proteins. Genes are the structural...
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20...
A: According to guidelines we have to answer the first question only. so please kindly post the remaini...
Q: What are carcinogens ?
A: Cancer is an abnormal growth and uncontrolled division of cells that spreads in the body and surroun...
Q: Which is mismatched? droplet - sick person sneezes directly on you fomite - toot...
A: Microbes are referred to as microorganisms that naked eyes can not visualize. They are present every...
Q: What are diagnostic tests that will benefit from collecting both a blood sample and amniotic fluid f...
A: The study of living things is called biology. It involves the anatomy, morphology, structure and fun...
Q: PART B 1. Pasteurized milk is allowed 20,000 CFU/mL. How many colonies would be present if 0.1 mL of...
A: According to bartleby expert guidelines when multiple questions are posted , we are allowed to answe...
Q: Given round and wrinkled plants, for which of these phenotypes would you be able to determine genoty...
A: Mendel studied 7 traits of pea plants. Out of these traits, the seed shape of the seeds has a domina...
Q: Why do these nuclear pores have to be larger in diameter than the channels in the cell’s plasma memb...
A: The cells are the primary unit of life. Based on the number of cells an organism may be prokaryotic ...
Q: Identify the phases of mitosis above:
A: Mitosis is the division of a diploid cell into two diploid daughter cells.
Q: I AM TRYING TO IDENTIFY THIS UNKNOWN. IMAGE 1 HAS TWO PICTURE OF CATALASE TEST AND BLOOD AGAR TEST. ...
A: Bacitracin Test -- Bacitracin is a bactericidal drug useful in the treatment of superficial skin in...
Q: What advantages did plants gain from the evolution of secondary growth?
A: The growth resulting from the cell division in lateral meristem or cambium which causes a thickening...
Q: Suppose a mutation in separase allows it to recognize but not cleave cohesin. What is the most likel...
A: Separase and cohesin are together important during cell division. Separase is a cysteine protease e...
Q: What is the Mechannism of Hemolysis in pnh
A: Hemolysis is the rupture of red blood cells and the cytoplasmic content release into the surrounding...
Q: Genetics MCQ
A: Histones are proteins that play an important role in the packing of DNA into cells, chromatin, and c...
Q: Explain briefly how i. human tears ii. breast milk secretion iii. mucus production help prevents inf...
A: There are 3 different kinds of immune barriers that helps our body to fight against bacteria. These ...
Q: Which part of the microscope is used to adjust the light? (pick one) i. h. a. d. c.
A: Light microscope is a microscopic instrument which uses visible light and magnifying lens to to view...
Q: In a population of birds, the average beak size is selected against, while large and small beak size...
A: Answer: ADAPTATION : It is the ability of an individual to alter or changes the physical and chemica...
Q: The diagram below shows a cell during Meiosis II: a) What phase of Meiosis II is the cell in? How do...
A: Meiosis is a reductional division. It reduces the chromosome number to half.
Q: Draw a Punnett square for the following crosses: а. Аа х АА b. Aа х Аа с. АаBb x aabb d. AaBb x AaBb
A: The Punnett square is a square diagram that can be used to predict genotypes in a cross or breeding ...
Q: ANALYZING. INSTRUCTION: MASS EXTINCTIONS THAT HAVE OCCURRED REPEATEDLY OVER GEOLOGICAL TIME. BRIEFLY...
A: Mass extinction refers to events that lead to the loss of fifty percent or more species of the total...
List the major events in the physiology of hearing.
Step by step
Solved in 2 steps
- Define and describe decussation and indicate the first level within the Central Auditory Nervous System that decussation occurs.In what way does the process of hearing illustrate the general principle of physiology that physiological processes require the transfer and balance of matter and energy?Define about Preventing Hearing Loss ?
- Explain the physiology of hearingDescribe the parts of the external, middle, and internal ear, and the receptors they contain, and discuss the processes involved in the senses of equilibrium and hearing.Discuss the somewhat surprising outcome of research on hearing loss in urban versus rural environments, and the physiological explanation behind it. Please include references.