Q: Why must the gene be inserted into a vector for it to be cloned?
A: Vectors are carriers of target DNA which are readily used in recombinant DNA technology. The most…
Q: Short tandem repeats (STR) profiling is based on O A. the fact that many foods are being genetically…
A: The method of DNA profiling used today is based on PCR and uses simple sequences or short tandem…
Q: you carry out DNA editing using CRISPR whter the editing template DNA has strands labeled with heavy…
A: DNA (Deoxyribonucleic acid) is edited with the help of several molecular tools. CRISPR (Clustered…
Q: #16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C |…
A: The sticky ends generated after cleavage by the Xho1 and Sal1 are shown on the white board.
Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Restriction endonucleases (RE) are one of the most used enzymes in biotechnology for recombinant DNA…
A: Restriction enzymes are the enzymes which cut DNA sequences at a particular site. Restriction enzyme…
Q: The technique of fluorescence in situ hybridization (FISH) is described. This is another method for…
A: Fluorescence in situ hybridization (FISH) is a technique used to study the genome complexity. FISH…
Q: Which of the following are not the functional components of a simple retroviral genome?
A: All retroviral genomes include at least four genes, which are the gag, pro, pol, and env genes. The…
Q: design a method to treat the most common mutation that causes sickle cell anemia using CRISPR/Cas.…
A: CRISPR Technology/ Clustered regularly interspersed short palindromic repeats is the technology…
Q: What does Cas9 do in CRISPR-Cas9 editing? O It makes double stranded breaks at specific locations in…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Terminal-sequencing reads of clone inserts are a routinepart of genome sequencing. How is the…
A: The whole-genome shotgun (WGS) method used for sequencing the DNA from the pool of many fragments by…
Q: Repeated sequences can be classified according to theirorganization in the genome as well as…
A: The heredity or inheritance is defined as the passing of traits from parents to their offspring. The…
Q: Please ASAP. Thank you. What is the mechanism of action for CRE recombinase in the CRE-loxP system
A: Cre recombinase is tyrosine based enzyme and is derived from P1 bacteriophage. It uses topoisomerase…
Q: Biolistic-mediated transformation
A: Gene delivery system: The cell membrane is semipermeable membrane, which is consist of phospholipid…
Q: What needs to happen so the reporter molecule can emit fluorescence that is not quenched?
A: Real time PCR is a technique used to monitor and quantify the PCR product reaction in real time. The…
Q: Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: A mulitple cloning site (MSC) is used in TOPA-TA cloning in TA cloning with restriction enzymes both…
A: The process by which genetic material from one organism is introduced into another organism to…
Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…
A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…
Q: robes for cloned genes use ____. a. certain bacteria that glow when they take up the genes b.…
A: Gene cloning: It is a procedure that makes researchers prepare several similar copies of gene-sized…
Q: Select all that apply. The Klenow fragment: has primase activity. is an E. coli DNA polymerase…
A: DNA polymerase is an enzyme, which helps in the synthesis of the DNA complementary strand from the…
Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…
A:
Q: CRISPR/Cas9 can be used in genome editing. Among the following statements, which one is correct?…
A: Bacteria have evolved various mechanism to resist against the viruses like bacteriophage some of…
Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…
A: EcoRI is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction enzyme…
Q: 33. Genes for medically important proteins can be cloned and inserted into bacteria, as shown in the…
A: Recombinant DNA is a technique discovered by scientists that allows a human gene to be inserted into…
Q: No Genome Left Behind and the Genome 10K Plan. Explain about this ?
A: The world has evolved. Ten years ago, it cost millions of dollars and many rooms filled with…
Q: A number of advances have been made in biotechnology. CRISPR/Cas9 one of the most controversial, and…
A: CRISPR/Cas9 is found in the prokaryote system Cas 9 is an enzyme that cut DNA
Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical…
A: ANSWER;- Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content =…
Q: Earlier, proofreading DNA polymerases used to have higher fidelity than that of Taq DNA pol. but…
A: PCR is polymerase chain reaction. It was used initially for polymerization of the small fragments of…
Q: What is the dna strand sequence for phosphate sugar backbone?
A: Disclaimer: - According to Bartleby guidelines only the 1st question can be answered when multiple…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: Introduction :- A nucleic acid sequence is a series of bases denoted by a set of five letters that…
Q: For the method of RNA sequencing (RNA-Seq), which of the followingis the correct order of steps?a.…
A: RNA sequencing is a method that is used to identify expressed genes. A transcriptome is defined as…
Q: SVCCPSLVARTNYNVCRLPGTEAALCATFTGCIIIPGATCGGDYAN Find the template? Use swiss model to build the…
A: The bioinformatic is major computational biology used to find the nucleotide, protein sequence of…
Q: molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: They are few methods which are used to to separate and identify the gene of interest. To isolate a…
Q: The optimal design of primers is critical to the effective amplification of DNA sequences. i)…
A: INTRODUCTION Polymerase chain reaction (PCR) is a method widely wont to rapidly make millions to…
Q: Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP…
A: In genetics, floxing refers to sandwiching the DNA sequence between two lox P sites. Lox P or…
Q: Gene transcription quantification . In gene copy number detection in DNA genotyping 1 When…
A: It is a nuclear derived polymerase chain reaction method. It can detect any genetic material in the…
Q: How does a DNA microarray work amd How do you make a DNA microarray?
A: DNA microarray is a collection of DNA sequences attached to a solid surface such as a glass slide…
Q: Fill in the gaps? One major goal/motivation in the development of synthetic genomes is ...... .…
A: In some ways, synthetic biology is similar to genome editing as both involve changes in the genetic…
Q: How does CRISPR work? (Not, "What is CRISPR?" although that is important to know, but how does it…
A: CRISPR, or Clustered Regularly Interspaced Short Palindromic Repeats, is a gene editing technology…
Q: CRISPR One of the more recent advances in biotechnology is the development of the CRISPR gene…
A: Given information: The CRISPR technology is the most recent advancement in the field of…
Q: Discuss the importance of adding radioactively labeled molecules during 16S ribosomal RNA sequencing…
A: The bacterial isolates can be identified accurately by the 16S ribosomal ribonucleic acid (rRNA). It…
Q: What is the meaning of proofreading activity ? O A. The polymerase checks for the correct…
A: DNA means deoxyribo nucleic acids. DNA act as genetic material in most organisms present on earth.…
Q: HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence…
A: Restriction enzymes are the molecular scissors and are used to cut at a specific site. These are…
Q: I recently isolated the human enzyme called fucosidase and prepared anantibody to it. Now I want to…
A: A probe is one of the essential components necessary to identify a gene during cloning. A probe is…
Q: Molecular recording involves... O Harvard University OA novel way to store large amounts of da O…
A: The embryonic development process involves a single cell called a zygote that undergoes cleavage to…
Q: Southern blotting is a method used in molecular biology for detection of a specific DNA sequence in…
A: Nucleic acid blotting is a well-established technique for locating a gene or sequence of interest…
Q: Review DNA sequencing and cloning tools. Match term and its description. a cloning vector that…
A: A cloning vector that contain a highly active bacterial promoter is called the expression vector .…
Q: What is the correct order to prepare pure recombinant proteins when using E coli expression system?…
A: Recombinant proteins are proteins that are encoded by recombinant DNA that is cloned in an…
Q: Expand PCR? Describe the different Steps involved in this technique?
A: PCR is an important technique in molecular Biology using which genes can be amplified easily. It…
Q: TALENs What is it? And how it works in genome editing? Including
A:
Step by step
Solved in 2 steps
- GCT GAC ATC CTC CTC mutated DNA sequence mutated mRNA sequence mutated amino acid sequence Above is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion汽 (0 hope this picture, https://www.phys.kSu.edu/gene/photos/sd.html. 2 will help you imagine the results for r
- Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAARNA sequencing can detect DNA mutations typically easier to analyze can detect transcripts with very low abundance Both Answer Bank used for gene-expression analysis Microarray requires transcript-specific probespcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
- CA Live Remote Consider the following chart: What type of mutation is this? * DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC UUA Amino acids: Met-Arg-Thr-Leu DNA: TAC GTA TGG AAT MRNA: AUG CAU ACC UUA Amino acids: Met - His - Thr- Leu substitution deletion insertion frameshift mutationGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…No Genome Left Behind and the Genome 10K Plan. Explain about this ?
- What is the role of the following molecules in the CRISPR mechanism? * Sequence of 3 nucleotide Not a RNA significant sequence Endonuclease motif that is Host genetic synthesized role in information to match a a binding CRISPR target site mechanism sequence Cas9 guide RNA DNA polymerase PAM Cellular DNA TRNA O O 口 ロ 口 ロロBamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?BIOINFORMATICS Please solve the questions about(Akt 1) can use NCBI Please help me 1.What is the official genename of the gene? Do you have another names? 2.Find nucleotide sequence of reference sequence of your gene. 3.Find refseq transcript number of your gene. Make BLAST of two of refseq transcript. Show the Blast result. (You can take screenshots) 4.Find refseq protein sequence number of your gene. And download the amino acid sequence of your gene. 5.What is the chromosome number is it located? 6.What are the coordinates of the gene? 7.How many bp is the length of the transcript? (Hint: not RefSeq transcript) 8.What is the transcript access number? 9.How many exons and introns does it have? 10. What is the sequence of the first exon? 11.How many nucleotides long is each exon? 12. What is the UniProt accesion number of your genes for human?