Q: What type of features do you feel should be used to classify humans as a species?
A:
Q: What will be the result if we resequence the same samples contributed to the reference genome and…
A: Many hereditary disorders may now be tested for through "genetic testing". Some diseases,…
Q: Whether a hair cell depolarizes or hyperpolarizes depends on whether it bends towards or away from O…
A: Introduction Hair cells, the inner ear's primary sensory receptor cells, convert mechanical inputs…
Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…
A: DNA is a double helical structure composed of two DNA strands.
Q: Many bacteria and other organisms can live without oxygen. What steps of cellular respiration do…
A: The oxygen is the colourless, odourless, gaseous element represented by the symbol “O”. It…
Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…
A: RISA is the technique for microbial community analysis. It helps in determining the species…
Q: choose a product of nanotechnology found at home. Discuss the purpose and how the technology is…
A: Nanotechnology essentially means employing the matter at a tiny scale, at the atomic and molecular…
Q: how do thermodynamics explain the ability of cells to do "metabolism" in general, or cellular…
A: Metabolism refers to the process through which the body converts food to energy to run vital…
Q: Mang Isko has one hectare corn production with high-value vegetable near in it. He wanted to apply…
A: The herbicides are mainly a medium used to kill unwanted plants or to arrest the growth of the…
Q: C Class: Common Name:_ ass: ammon Name:
A:
Q: Which of the following BEST describes DNA replication? a. Conservative b. Semiconservative c.…
A: DNA ( Deoxyribonucleic acid) is two stranded helical structure which act as genetic material in most…
Q: Describe two ways in which Vesalius improved medical educationand set standards that remain relevant…
A: Introduction Andreas Vesalius was a 16th-century anatomist, physician, and author of De Humani…
Q: Describe a variety of organic compounds present in living organisms, and explain their importance to…
A: Because of their relationship with organisms and the fact that they include carbon, the chemical…
Q: Name five functional traits of microorganisms. What dose the functional diversity describe? Do we…
A: Functional traits of the microbes describe individually expressed phenotypes or characteristics of…
Q: .1 Explain what MI and M2 patterns indicate (fungal genetics)
A: M in M1 and M2 stands for macrophage.A macrophage is a White blood cell which is used for killing…
Q: If twin brothers fathered 2 boys, (one each) by different women, would the 2 boys have any simular…
A: The human genome is a full set of nucleic acid sequences for humans, encoded as DNA in cell nuclei's…
Q: Describe how specific molecules are used to change the gene expression of a gene in a cell. Explain…
A:
Q: Q3.9. For which of the following is potential energy DECREASING? (Hint: Click here to see an…
A: INTRODUCTION Potential energy is stored in living cells in the form of ATP.
Q: The mitral valve is located between the
A: The mitral valve or bicuspid valve is located between the left atrium and left ventricle.
Q: Place the steps regarding fat digestion and absorption in the correct order. The abbreviation TAG is…
A: Introduction Digestion is the process of breakdown down food into smaller particles that can be…
Q: A transmembrane protein has the following properties: it has two binding sites, one for solute A and…
A: Introduction :- Transmembrane proteins (TP) are integral membrane proteins that traverse the entire…
Q: Predict which one of the following organisms will have the highest percentage of unsaturated…
A: Introduction :- Each phospholipid is made up of two long chains of atoms known as fatty acids. There…
Q: Match the mineral to its main function. chloried insulin enhancement sodium, potassium thyroid…
A: Insulin A hormone that controls the level of glucose in the blood stream.
Q: Name Some of the the techniques are used for resolution up to species and strain levels. Culturing…
A: There are various techniques present to identify bacteria at strain and species level. Some of them…
Q: 2. What is the name of the tissue (the structure) labeled A? 3. What is the name of the tissue (the…
A: Tooth Development or Odontogenesis is the complex process by which teeth form from embryonic cells,…
Q: Why its important in biomechancs field, Internal Fixation and External Fixators of Bone Fracture..…
A: External fixation is a surgical treatment used to set bone fractures in which a cast would not allow…
Q: 15. In which of the following forms is energy immediately made available for the use of living…
A: Each body cells need energy in order to perform various body or metabolic functions. The energy can…
Q: Answer the questions in the frame below. 1. What organ(structure) is shown in the figure? 2. What is…
A: Introduction The liver is the body's largest solid organ as well as the largest gland. It performs…
Q: You are walking down the “tough streets” of New Jersey, and suddenly you feel the need to run away…
A: Introduction Biological macromolecules are huge molecules that are made up of smaller organic…
Q: 2. A white cat (W) and a brown cat (B) mate and the offspring is an orange cat (WB). white cat brown…
A: Introduction Incomplete dominance is a type of gene interaction in which both alleles of a gene at…
Q: Explain why bacteria are limited to growth within a given temperature range? Explain why bacteria…
A: Bacteria are single-celled organisms with a small size. Bacteria can be found practically everywhere…
Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…
A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…
Q: Which Omics techniques is known as environmental genomics or community genomics? Write advantage and…
A: The structure and function of complete nucleotide sequences isolated and analysed from all of the…
Q: Which statement regarding cell reproduction is true? Multiple Choice Cell division occurs prior…
A: Introduction Cell division is the process through which a mother cell divides into two or more…
Q: PATHOLO No 5 TASK No 1 A 24-year-old patient was admitted to a psychiatric hospital with a diagnosis…
A: Hysterical neurosis is the disease that is associated with the nervous disease which affects the…
Q: Which of the following not a characteristic of immur secondary response? ○ IgG isotype ○ No lag…
A: This is the subsequent immune response after the primary immune response, also known as the…
Q: hydroxychloroquine directly and indirectly inhibits immune activation by reducing cytokine…
A: Introduction: Hydroxychloroquine, which was first used as an antimalarial, is now utilised to treat…
Q: 10. The electron transport chain requires energy to synthesize ATP, this energy is derived from A…
A: Introduction An electron transport chain is a series of protein complexes and other molecules that…
Q: Role of Molecular Biology in Evolutionary Classification
A: Introduction :- The study of the molecular basis of biological activity in and between cells,…
Q: Match the water soluble vitamin with its deficiency megaloblastic anemia, cognitive decline, age…
A: Vitamins are the key component of cellular pathways for example- hydroxylation of collagen protein…
Q: 7 Use the following images to answer the next two questions. 5 6 Stage 8 in the diagram above is…
A: The given diagram illustrates cell division. There are two types of cell division - mitosis and…
Q: Arthritis diseases are due to: in the veins is lower than in the arteries. When a person stands…
A: Arthritis It is a common disorder in which the joints are affected. This condition causes pain and…
Q: 6.8 Define a map unit and explain why map units best reflect the real distances between two genes…
A: Genetic map are used to represent the linkage of genes in a chromosome. Genetic maps are mainly used…
Q: True or false: The hydrolysis of ATP is exergonic (spontaneous) True False
A: Metabolism is a phenomenon in which energy is either liberated or formed . Metabolism is classified…
Q: Function of cerebrum
A: Introduction :- The cerebrum is the brain's biggest portion. Memory, speech, the senses, and…
Q: Darwin and the Theory of Evolution - V2 So how and why did Charles Darwin come to develop his…
A: Charles Darwin gave his famous theory of natural selection. According to this theory nature selects…
Q: de bien Class: Genus: Common Name: Dorsal Ventral
A:
Q: typical labeled sketch of a bacterial growth curve in batch culture
A: Batch culture is a laboratory culture method in which bacteria has grown in large scale. Here…
Q: The Innate and the adaptive Immune Response of coronavirus explain ?
A: Introduction: The mechanism wherein the body tries to defend itself against potentially harmful or…
Q: Table 1: F1 ebony flies - 0 F1 non-ebony flies - 560 F1 stubble flies - 560 F1 non-stubble…
A: In genetics, the genes forms the basic inheritance units with its alternative forms called alleles.…
Write short notes on dry heat as a physical antimicrobial control method.
Step by step
Solved in 2 steps
- Give a short comparison between alcohols and aldehydes as chemical antimicrobial agents.Briefly compare filtration and ionising radiation as antimicrobial control methods.Explain the usage as antimicrobial agents and disinfectants of Phenol and phenolics, alcohols, halogens, oxidizing agents, surfactants, Heavy metals, aldehydes, gaseous agents and enzymes
- Soap and detergents are categorized as which type of antimicrobial chemical? oxidizing agent aldehyde surfactant alcoholExplain why the type and number of microbes, environmental conditions, risk for infection, and composition of the item influence the selection of an antimicrobial procedure.Provide a review of related study on the use of calamansi rinds extract as an alternative to alcohol-based hand sanitizers where antimicrobial activity is the variable. Cite the citation as well and follow the rrs format.