Write a program that creates the file "LetterGrades.txt" filled with 1000 randomly generated letter grades. Letter grades: A+, A, B+, B, C+, C, D+, D, and F.
Q: In main.py define the Product class that will manage product inventory. Product class has three…
A: Introduction In main.py define the Product class that will manage product inventory. Product class…
Q: A multicast overlay effectively pushes streaming content from a single source to multiple…
A: According to the question , we have to explain CDN effectively pulls content (including videos) down…
Q: It is well known that computers operate in binary. Why aren't alternative systems like decimal,…
A: Logic behind why computers utilise the binary number systemThe following are some of the primary…
Q: Giving reasons for your answer, suggest two important types of application where you would not…
A:
Q: Find out how to configure an HTTP server so as to eliminate the 404 not found message and have a…
A:
Q: What kinds of analyses are possible with NLOGIT software?
A: NLOGIT Software is a plece of software that was developed by NLOGIT.
Q: What determines the sequence of events that take place when a user executes a program in a…
A: The assertion: What elements are required to control the sequence of events while running a program…
Q: Home Page Checker Bonus Question: Compound Random experiment: Flip a penny, draw a marble from a bag…
A: The above question is solved in step 2 :-
Q: This is H1 Tag in HTML This is H2 Tag in HTML
A: The h1, h2 tags are used to define HTML headings.
Q: What do you mean by "partitioning" in terms of operating systems? Consider the benefits and…
A: Given: When it comes to operating systems, we need to have a conversation about what precisely you…
Q: One feature of the existing DNS.com hierarchy is that it is extremely wide. (a) Propose a more…
A: Domain Name System Domain Name System (DNS) is a progressive plan of the PCs associated with the…
Q: 7. Assume that an IP address is 136.159.7.2. a) What class of address is it? b) Write the address in…
A: The given IP address is 136.159.7.2 It belongs to Class B because the class B first octet ranges…
Q: Why does public-key cryptography assist IoT and why are wireless systems necessary?
A: Electronic device will definitely need security when they are interconnected with Internet of Things…
Q: Analyze and determine the outputs of the following program statements: #include #include int…
A:
Q: Suppose we want an error-correcting code that will allow all single-bit errors to be corrected for…
A: Below is the answer to above question. I hope this will be helpful for you.. .
Q: Question #5 Transfer the following verbal description into a unified ER model: a) A flight…
A: Build an ER model to manage an airport with the following requirements: • A flight is made up of one…
Q: Describe the hosting methods for network services and applications based on the cloud.
A: Describe the hosting methods for network services and applications based on the cloud. Answer:…
Q: st to code.!
A: I have written the code below:
Q: Q. Which is used to iterate the values in Hashtable?
A: There are multiple methods to iterate values in Hashtable in JAVA Five methods are given below with…
Q: Suppose a host elects to use a name server not within its organization for address resolution. When…
A:
Q: Consider the following table employees (employee_id, first name, last name, email, phone number,…
A: Given that, the name of the table is employees. employee table attributes: employee_id, first_name,…
Q: Base on the Relationship diagram. 19.Display the date of the most recent departure flown by each…
A: Based on the relationship diagram the sql quires are represented in Step 2.
Q: the ability for a use to purchase. a "Calculate Cost" button that will calculate o the subtotal of…
A: Program plan:- step by step Initialize variables to store TAX, index, and total cost. Define the…
Q: Use C++ Prog language Required: 1. First 3 lines of code will be three comment lines a. Name of…
A: The C++ code is given below with output screenshots As the percentage of Sales Tax is not mentioned…
Q: Give a concise overview of the advantages and disadvantages of using connectionless protocols…
A: answer is
Q: An array with no elements is. automatically furnished one value-the null terminator illegal in C++…
A:
Q: One feature of the existing DNS.com hierarchy is that it is extremely wide. (a) Propose a more…
A:
Q: What kind of firewall program is installed on a computer running Windows Server?
A: Introduction: A firewall is a hardware or software network security tool that keeps track of…
Q: ignite DFDs?
A: THE TECHNIQUE OF DATA FLOW DIAGRAMMINGThis section describes in detail the data flow diagramming…
Q: Explain how the principles underlying agile methods lead to the accelerated development and…
A: The answer of the question is given below
Q: Describe the development of a programming language.
A: In the given question programming language is a vocabulary and set of grammatical rules for…
Q: Other examples: SOLVING COMPOUN Roll two dice Flip 3 coins (p,n,d) Draw 3 cards from a poker deck…
A:
Q: To access the services of the operating system, the interface is provided by the a) Library b)…
A: Operating system (OS) is the programme that controls the all other application programmes in a…
Q: List some features of the risc architecture.
A: RISC stands for Reduced Instruction Set Architecture. RISC tries to improve CPU performance. RISC…
Q: Q. Give Example of H2 and H3 tag in html?
A: Answer : h2 tag is the subheading of h1 tag like H1 is the main heading or title like Shoes .
Q: What is a Java?
A: Given: A Java is what?
Q: What kind of firewall program is installed on a computer running Windows Server?
A: Introduction: A firewall is a hardware or software network security tool that keeps track of…
Q: Update the provided code to a code that uses while loop and then simulate. const int PinLed =…
A: Answer:-
Q: What does a one-to-many connection entail in the context of a high-level language compared to…
A: Answer : one to many relationship indicates that the single elements , statements , or set of…
Q: Set apart network services and applications that are cloud-based from those that are on-premises.
A: Network Services: A network service in computer networking is an application that runs at the…
Q: VPN bits Number of VPO bits PPN bits PPO bits
A: The answer is
Q: What precisely does "wireless security" mean?
A: Wireless security provides the security to the network by using the wireless connection. It prevents…
Q: Q. Give Example of H2 and H3 tag in html?
A: HTML specifies six heading levels. A heading element entails all font changes, paragraph breaks…
Q: What does Interrupt Processing really mean?
A: Interrupt: Any processing that needs other work besides the processing of the jobs is done via…
Q: Write a class that instantiates a Scanner object and asks the user for their grade, represented by…
A: Java James Gosling create Java at Sun Microsystems, where it was first released as a key element of…
Q: Network-based cloud services and applications
A: Given: We need to explain about network based cloud services and applications.
Q: Give an example of an organization and describe how it employs databases in its information systems.
A: Given: Give an example of an organization and describe how it employs databases in its information…
Q: PROVIDE JS SOURCE CODE Design a web page with a text box (username) where the user can enter a name…
A: Code : <!DOCTYPE html><html lang="en"><head> <meta charset="UTF-8">…
Q: A control's property governs whether or not it is shown on the form during runtime, much like with…
A: Attribute Control : Attribute Control Charts are a gathering of control diagrams expressly made for…
Q: In order for virtual memory systems to be efficient, what hardware approaches must be employed? What…
A: Virtual memory is an operating system feature that allows a computer to compensate for physical…
Step by step
Solved in 2 steps with 3 images
- The Directir file contains namés línhe employees and their phone numbers in the following order: Last name, First name, Phone. The creator of this file made several mistakes by typing commas and dots inconsistently. Write a Python program to read this file and produce an output file with the name DirectoryNew.txt. This file should format the phone directory as follows: Phone First name Number 1 First name 1 Number 2 First name 2 The file MUST end with: End of directory Edit Metadata Edit Metadata Content of the input file The output should be as follows Springsteen, Bruce, 2587. Hassan, Amir, 6958. Phone First name Homes, Rebecca, 5263 Smith, John, 5252 MacDonald, Mirna, 8965! Pichai, Sundar, 9632. Jobs, Steve, 1002 2587 Bruce 6958 Amir 5263 Rebecca 5252 John 8965 Mirna 9632 1002 Goldsmith, Micheal, 5478. Sundar Yassir, Ammar, 8885 Steve Nicholas, Jack, 4696 5478 Micheal 8885 Pang, Chee, 9898 Lee, Andrew, 7412. Jimenez, Dragos, 6547 Ammar 4696 Jack 9898 Chee 7412 Andrew 6547 Dragos…The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonIn Python Take the Deck of cards we created in Problem Solving Exercise: Shuffle and Deal Cards and write the (unshuffled) deck to a csv file. It should create a csv file with a card per row with the name, value and suit in each row (example below): 2 Spades 2 3 Spades 3 4 Spades 4 5 Spades 5 6 Spades 6 7 Spades 7 8 Spades 8 9 Spades 9 10 Spades 10 J Spades 11 Q Spades 12 K Spades 13 A Spades 14 2 Hearts 2 3 Hearts 3 I'm so confused with this question. below is my code for this
- The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionThe file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAAThis is a Python program Reads information from a text file into a list of sublists. Be sure to ask the user to enter the file name and end the program if the file doesn’t exist. Text file format will be as shown, where each item is separated by a comma and a space:ID, firstName, lastName, birthDate, hireDate, salary Store the information into a list of sublists called empRoster. EmpRoster will be a list of sublists, where each sublist contains the information for one employee.The birthDate and hireDate in file are strings, but should be stored as objects of type Date.Example of EmpRoster list with 2 employees:[ [111,”Joe”, “Jones”, “09-01-1980”,”10-19-1999”, 95000], \ [222, “Sam”, “Smith”, “07-10-1956”,, “01-01-2000”, 50000] ] Print a report that shows the following: Employee RosterID First Name Last Name Birth Date Age Hire Date YrsWorked Salary WRITE the following information out to a text file – ask the…
- In C++ (don't copy paste the same answer that is already on this site, post unique code) Structures A menu-driven program gives the user the option to find statistics about different baseball players. The program reads from a file and stores the data for ten baseball players, including player’s team, name of player, number of homeruns, batting average, and runs batted in. (You can make up your data, or get it online ) Write a program that declares a struct to store the data for a player. Declare an array of 10 components to store the data for 10 baseball players. The program prints out a menu (in a loop, so this can be done again and again) giving the user a choice to: print out all users and statistics print out the statistics for a specific player print out all data for a specific team update the data for a particular player (change one of the statistics) DO ALL WORK IN FUNCTIONS. USE A FUNCTION TO READ THE DATA, A FUNCTION TO PRINT THE MENU, and FUNCTIONS FOR EACH OF THE MENU…In python please Lab: Faculty Salaries 1. Create a data file, called salary.txt, with 100 lines. 2. Each line in the file consists of a faculty:a. First nameb. Last namec. Rankd. Salary 3. For the first and last name use:ith line FirstNamei and LastNamei 4. The rank is randomly generated as assistant, associate, and full. 5. The salary is randomly generated as a number with two digits after the decimal point. a. Assistant Professor 50,000 – 80,000b. Associate Professor 60,000 – 110,000c. Full Professor 75,000 – 130,000 6. Sample data:FirstName1 LastName1 assistant 59125.75 FirstName2 LastName2 full 112800.25...FirstName100 LastName100 associate 89355.23 7. Using salary.txt that you created, write a program to display the following: a. Total salary for assistant professor, associate professor, and full professor b. Average salary for each.Code should be in Python. A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names. Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. (Examples in image)
- In python The text file “studentMarks.txt” has been provided for you. Each line contains the Last Name, First Name and 8 marks separated by spaces of a single student. For each student in the file, adjust the file to include the average of their top 6 marks, rounded to 1 decimal place, at the end of the line. For example, in the file, the line may say: Mars, Bruno 82 82 85 94 65 79 81 90 Afterwards, it should be updated to say: Mars, Bruno 82 82 85 94 65 79 81 90 Top6Avg: 85.7 Your program must define a function to determine the average of the top 6 marks. You may define more functions as needed for your program.1. Random numbers File: random_numbers.py (Quick note: NEVER name your files the same as a Python module. If you call this file random.py it won't let you import the real random.) (Another quick note: Don't let yourself get stuck on something for too long. If one part of one question starts taking you too long, just leave it, move on and come back to it later.) Write a complete Python program that ask the user for quantity of random numbers and a maximum, then generates and store that many numbers between 0 and the maximum. When you've got this part working, add the following interesting additions: minimum maximum random choice from existing list (Hint: if there are 7 numbers it will be a number at a random index 0-6) the list reversed* the list sorted* Note*: Python's .reverse() and .sort() list methods do NOT return the reversed or sorted list... they modify the list in place.So, if you write something like: print(numbers.sort()) You will not get what you expect. You'll sort the…This is for Python version 3.8.5 and please include pseudocode. A file named gang.txt is shown below. Write Python code that opens this file, reads only the first two lines, and prints “Penny is 19” gang.txt (contents of file) - please create on with the data provided in order to complete this question. Thank you! Penny 19 Kenny 20 Benny 21 Jenny 20