While trying to determine the structure of DNA, Watson and Crick at one point proposed that like bases are bonded to like bases. For example, thymine would be bonded to thymine, cytosine would be bonded to cytosine, and so on. Explain why this proposed model would not fit based on what was discovered to be true about DNA.

While trying to determine the structure of DNA, Watson and Crick at one point proposed that like bases are bonded to like bases. For example, thymine would be bonded to thymine, cytosine would be bonded to cytosine, and so on. Explain why this proposed model would not fit based on what was discovered to be true about DNA.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

X-ray was used by Rosalind Franklin and Maurice Wilkins to study the molecular structure of DNA. Why is their finding not accepted by Watson and Crick? Explain.
Watson and Crick, the pair of researchers who determined the structure of DNA, deduced the pairing of nucleotides in DNA using information learned from Erwin Chargaff. Which of the following is the correct pairing of nucleotides in DNA? a guanine with adenine; cytosine with adenine b adenine with thymine; guanine with cytosine c cytosine with guanine; uracil with adenine d cytosine with adenine; thymine with guanine
In the early 1950s, it became clear to many researchers that DNAwas the cellular molecule that carries genetic information. However,an understanding of the genetic properties of DNA couldonly be achieved through a detailed knowledge of its structure.To this end, several laboratories began a highly competitive raceto discover the three-dimensional structure of DNA, which endedwhen Watson and Crick published their now classic paper in 1953.Their model was based, in part, on an X-ray diffraction photographof DNA taken by Rosalind Franklin (Figure 9.10). Two ethical issuessurround this photo. First, the photo was given to Watson and Crickby Franklin’s co-worker, Maurice Wilkins, without her knowledge orconsent. Second, in their paper, Watson and Crick did not creditFranklin’s contribution. The fallout from these lapses lasted fordecades and raises some basic questions about ethics in science. What vital clues were provided by Franklin’s work to Watsonand Crick about the molecular structure…
You have a sample of genetic material. The nitrogenous base content is 29% guanine. a) If the sample is DNA, what are the amounts of the other bases? Explain your thought process b) Why can you not determine the amounts of the other bases if the sample is RNA? Explain your answer c) How did Watson and Crick make use the relationships between base pairs as they constructed the model for DNA?
The proposed model of the DNA double helix by Watson and Crick was based on earlier findings the DNA structure is a helix and that the number of bases or nucleotide C+A is always equal to G + T. With this in mind, what is the number of hydrogen bonds that hold this DNA helix with the following sequence: AGGTCTTCGTGGCCTA TCCAGAAGCACCGGAT 28 58 41 38
Which one of these facts would NOT be needed in order to determine the correct base sequence from the image of DNA in the question above? Adenine and guanine are purines with a two-ring chemical structure. Cytosine and thymine are pyrimidines with a one-ring chemical structure. Adenine pairs only with thymine using two hydrogen-bonds. Cytosine pairs only with guanine using three hydrogen-bonds. All of the facts above are needed.
Which of the following statements DOES NOT apply to the Watson and Crick model of DNA? a. The two strands of the DNA helix are anti-parallel. b. The distance between the strands of the helix is 20 angstroms (A). c. The framework of the helix consists of sugar-phosphate units of the nucleotides. d. The two strands of the helix are held together by covalent bonds. e. The purines are attracted to the pyrimidines. ...Explain your answer.
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Which of the following features is associated with the Watson and Crick model of the DNA? sugar-phosphate-base is the backbone of the helix B two antiparallel strands form the right-handed helix a purine always pair with a purine two antiparallel strands form the left handed helix
The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'
Which of the following is not included in the Watson-Crick model of DNA structure? The strands run parallel to each other. The resultant helix is right-handed. Strands are held together by hydrogen bonds between nitrogenous bases. The bases are held together in the central region of the molecule by hydrogen bonds. It is composed of two strands.
Watson and Crick used an approach called model building to deduce the structure of the DNA double helix.How does this differ from the more conventional experimental approach that is undertaken in a research laboratory? In this regard, why was the experiment of Meselsonand Stahl considered to be of such critical importance?