Q: Draw the structure of the amino acid arginine and indicate all ionizable groups
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four…
Q: How many of the amino acid N are there in this structure?
A: Daptomycin is a cyclic lipopeptide antibiotic. It is used for treating skin infections, right-sided…
Q: how can you determine if a protein sequence is functional using amino acids?
A: A protein is a polymer of amino acid. The primary structure of protein begins with the amino…
Q: What are the subunits that nucleic acids are made of? Briefly explain the difference between DNA and…
A: Macromolecules are vital structures that perform various roles in the human body. They are broadly…
Q: How many nucleotides are needed to code for a protein with 500 amino acids?
A: Amino acids are encoded by a set of three consecutive nucleotides known as a codon. One codon codes…
Q: Uracil is nitrogenous base and nucleosides?
A: Ribonucleic acid (RNA) and Deoxy ribonucleic acid (DNA) is the genetic material of most organisms…
Q: What do 3' and 5' ends of nucleic acids refer to ?
A: The structure of the nucleic acid is given below:
Q: Identify the ff nucleic acid bases and then classify whether it is a purine or pyrimidine.
A: Nucleic acids are also known as polynucleotides. Monomeric units of nucleic acids are called…
Q: What is the function of the structure labeled A?
A: Annelids are bilaterally symmetrical(can be divided into two equal segmants), triploblast(have three…
Q: How did nucleic acid synthesis (which requires many protein enzymes) and protein synthesis (which…
A: Nucleic acid synthesis is a process, during which new DNA is synthesized from the parental DNA…
Q: (a) Identify the base and monosaccharide in the following nucleotide. (b) Give the name and three-…
A: Nucleotides are the building blocks of nucleic acids which are the organic molecules that are…
Q: Why are gyrase and helicase required?
A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two DNA…
Q: Where do terms 5’, 3’ in nucleic acids come from?
A: DNA and RNA are nucleic acids tht are present in cells serving functions such as the carrier of…
Q: List the three components of a nucleotide.
A: Nucleotide: It is the basic unit of DNA and have 3 components- a Nitrogenous base, a pentose…
Q: Name the enzyme which helps in formation of peptide bond?
A: The peptide bond is a chemical bond and is formed when the carboxyl group of one molecule reacts…
Q: Draw out the structural formula of the oligopeptide, with the first amino acid as the N-terminus
A: Amine and carboxylic acid groups in amino acids are joined together, and forms chains of amino acids…
Q: Is the sugar in the nucleotide deoxytibose or ribose? How do you know?
A: DNA/RNA is made up of monomers of nucleotides .
Q: Why is hydrolysis of a protein not considered to be denaturation?
A: Hydrolysis is a chemical process in which a molecule of water is added to a substance. Sometimes…
Q: Why is the exact order of amino acids (primary structure) in a protein important?
A: Amino Acids : Amino acids are organic compounds that combine to form proteins. Amino acids and…
Q: Which type of bonds exist between paired nitrogenous bases?
A: Nitrogenous bases are the monomers that join to form the genetic material. The nitrogenous bases in…
Q: Would the peptide group be planar if the amino group of amino acids was bonded to the β carbon of…
A: Peptide group is generally linked to the amide bond that links the α-amino nitrogen of one amino…
Q: Draw out the structural formula of the oligopeptide, with the first amino acid as the N-terminus.
A: 1. Protein primary source is linear sequence of amino acids in peptide or protein. Primary…
Q: Which are the nucleotides "portions" that bind in the formation of nucleic acids? What is meant by…
A: The term nucleic acid is associated with the biomolecule that plays an important role in storing as…
Q: Describe the structure of a nucleotide and the general structureof a nucleic acid.
A: Nucleic acid and nucleotides are essential components of DNA and RNA (genetic material). The…
Q: Describe base pairing
A: DNA (deoxyribonucleic acid) is a double helix structure with two strands that travel in opposite…
Q: If YES, DNA is another nucleic acid, can this be hydrolyzed by an acid? what are the products…
A: DNA is a nucleic acid and nucleic acids are the polymers of nucleotides. Nucleotide contains…
Q: glutamic acid were replaced by proline in a protein
A: Glutamic acid is a hydrophilic amino acid whereas proline is hydrophobic. The polar acid R group of…
Q: What constitutes the backbone of a nucleic acid?
A: Introduction: A nucleic acid is a biological large molecule composed of nucleotide chains. These…
Q: The base sequence of which type of RNA is responsiblefor determining the order of amino acids in a…
A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…
Q: What base is missing in RNA and what base replaces it?
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Is oligonucleotide a protein?
A: The nucleotide is a building block of nucleic acids that is DNA and RNA. The base, phosphoric acid,…
Q: Do Carbohydrates Provide a Structural Code?
A: Carbohydrates are biomolecules that consist of carbon, hydrogen, and oxygen. these are the major…
Q: Name the nucleic acid
A: DNA is deoxyribonucleic acid; it is a genetic material present in each and every living cell and…
Q: draw the hydrogen bonds for the following nucleic acid base pair: G and C
A: In nucleotides, nitrogenous bases are aromatic heterocyclic substances. Purines and pyrimidines are…
Q: Which generic class of reaction results in the phosphodiester bonds of nucleic acids, analogous to…
A: In nucleic acid, the nucleotides are connected to each other through the formation of a…
Q: Name the bases in the pentanucleotide with the sequence G-A-U-C-A. Does this come from RNA or DNA?…
A: The nucleic acids Deoxyribose sugar (DNA) and Ribose sugar (RNA) are nucleotides that are made up of…
Q: Describe and identify nucleic acid chains in DNA and RNA.
A: Our cell possesses only two types of genetic material that is DNA and RNA, which are involved in…
Q: How does the alpha-helix result from hydrogen bonding?
A: Alpha-helix : It is a common motif in the secondary structure of proteins and is a right hand-helix…
Q: What kind of repeating polynucleotide would yield a single polypeptide with a tetrapeptide repeating…
A: Polynucleotide is a sequence of nucleotides. Nucleotides consist of a sugar molecule, a phosphate…
Q: What are the three parts of a nucleotide
A: Nucleotides are the building blocks of nucleic acids, viz. Deoxyribose nucleic acid (DNA) and Ribose…
Q: Draw the structure of the first 3 nucleotides in the nucleic acid sequence attaaaggtt tataccttcc…
A: Introduction: A nucleotide consists of a nitrogen base, a pentose sugar, and a phosphate group.
Q: What kind of macromolecule is shown in the image?
A: Biochemistry deals with the study of the structure and functions of molecules involved in the living…
Q: Name the nitrogenous bases that are bonded
A: Given image shows nitrogen bases. Both of them are heterocyclic aromatic rings. One contains two…
Q: What is required to form a phosphodiester bond withanother nucleotide ?
A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…
Q: Two proteins with the same amino acid composition do not have the same primary structure. Explain…
A: Protein Proteins are the polymers of nitrogenous compounds called amino acids. Each amino acid…
Q: What is a nucleotide
A: Nucleotides are of 4 types based on nitrogen bases. The nitrogen bases in the DNA are adenine,…
Q: In the tertiary structure of a protein, which pair of amino acid side chains would be most likely to…
A: Introduction: Protein are the most bountiful natural particles of the living framework. They can be…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.What is the nucleotide sequence of the complementary strand of this DNA molecule A TGCGA? CATAG O A AT G CGA O TACG CT CCGTTATIf this sequence of bases was on one side of a DNA molecule, what would be on the opposite side? AAATCGG * CCCATGG TTTGCAA UUUAGCC TTTAGCC Sign out Lenovo esc @ # 7 8. 9. 1 2 3 4 e r y u tab d f g. a C alt ctr alt
- A DNA sequence such as the one shown below has symmetry. 5' TGGAATTGTGAGCGGATAACAATT 3 3' ACCTTAACACTCGCCTATTGTTAA 51. Using this image of DNA & RNA explain the difference between DNA & RNA NH Thymine Cytosine Adenine Guanine Nucleobases of DNA Base pair Helix of sugar phosphates DNA Deoxyribonucleic acid read and then summarize in YOUR OWN WORDS Nucleobases RNA Ribonucleic Acid NH Uracil Cytosine Adenine Guanine Nucleobases of RNARNA is hydrolyzed in basic solution, but DNA is not. This occurs because ORNA has modified bases, but DNA does not thymine is found in DNA, and uracil is not O DNA contains 2'-deoxyribose, but RNA does not O DNA is double stranded, and RNA is single stranded
- Examine the 5'- 3 sequence of bases of the DNA molecules (A D) shown below. I am only showing you the 5 - 3' strand of each molecule, but you can imagine the complementary 3' - 5' strand for each molecule. Which double-stranded molecule is held together by 10 hydrogen bonds? O AAAT O ATAG O TGTC O GCGAIf all you know about a single stranded nucleic acid is that it has 30% Uracil, then which of the fållowing is TRUE: O it will form a right handed helix O you won't know the ratios of the other 3 bases O it is definitely an mRNA sequence O none of the answers are correct O you will only find this nucleic acid type within the nucleusDNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLY
- When comparing the structures of RNA and DNA, which of the following statements is TRUE? OA Only RNA has a ß N-glycosidie linkage to a base OB. Neither RNA or DNA has an ß N-glycosidic linkage to a base c. Only DNA has aB N-glycos.dic linkage to a base OD Both RNA and DNA have aß N-glycosidic lınkage to a baseWhich of the following best describes this nucleic acid? 6. The diagram below shows a portion of a nucleic acid and nucleotide sequence. A double-stranded DNA B double-stranded RNA HN- CH N-CH H. © single-stranded RNA O single-stranded DNA Uracil (U) (sicThe sequence below is one strand from a double-stranded DNA molecule. How many hydrogen bonds hold this double-stranded molecule together? 5' TATTCCGATAG 3' O 22 26 29 O 3 O 52 O Ooo
