Which term describes a substance that causes damage to the fetus during prenatal development? lanugo Oblastocyst teratogen epidural

Q: Which of the situations below will enhance microtubule growth? O addition of a drug that inhibits…

A: The third key part of the cytoskeleton, microtubules, are hard, hollow rods with a diameter of…

Q: Explain a way that sensory nervous system transduce stimuli with different strengths using concept…

A: The nervous system is a complex network of nerves and cells that send signals throughout the body.…

Q: What does the term transformative healthcare policy formulation mean and what are some examples?

A: Introduction Healthcare is a system of services, institutions, and practitioners that are dedicated…

Q: How do mitosis and meiosis differ? Q 15 of 15 Meiosis occurs as sex cells reproduce and engage in…

A: Mitosis and meiosis are the two processes through which cells divide and reproduce. Meiosis produces…

Q: Describe and compare at least two differences in the stem architecture of the ferns and the ancient…

A: INTRODUCTION A stem architecture is a type of software architecture that is built around a core of…

Q: Golden Line: Rationale: (Tell me why the authors put this diagram here. What do you think is its…

A: The fluid mosaic model is a widely accepted theory that describes the structure and function of the…

Q: For Dalmatian dogs, the spotted condition is dominant over non-spotted.  (a) Using a Punnett square,…

A: The spotted condition is dominant over non-spotted Dalmatian dogs. Symbols- Spotted allele- S…

Q: If the mutation occurred in Jonathan's somatic cells when he was in his 30's, what type of alleles…

A: A neurodegenerative condition that is primarily inherited is Huntington's disease (HD), also known…

Q: A genetic mutation leading to under expression of a cell membrane receptor would have the most…

A: Introduction :- Genetic mutation refers to a permanent change in the DNA sequence that makes up a…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: What is a typical feature of tissues that are involved in exchange of energy and materials with the…

A: Introduction:- Cells are the basic structural and functional unit of life. Cells performs all the…

Q: Which is a characteristic of a wild-type allele? Check All That Apply A wild-type allele determines…

A: Introduction :- The wild type allele is the most common, naturally occurring form of a gene that is…

Q: natural selection that leads to evolution of phenotypic differences A. Stabilizing selection…

A: Natural selection is the process by which species change over time as a result of environmental…

Q: Clearly state two important SIMILARITIES in FUNCTION and two important DIFFERENCES in FUNCTION…

A: Immunity is an organism's body's ability to protect itself from non-self infections and maintain…

Q: Using your knowledge of lipid structure and properties and any other scientifically reliable online…

A: Introduction :- HDL, or high-density lipoprotein, is a type of cholesterol that is often referred to…

Q: 18. What is a codon? 19. List each codon from the mRNA molecule in # 18 (put a dash between each…

A: The sequences in DNA or RNA constitute nucleotides that are made up of bases (adenine, thymine…

Q: what is an aquatic imsect order where adults and larvae are aquatic

A: Insects that can survive and even thrive in watery environments like lakes, ponds, and rivers are…

Q: GM foods are sometimes derided as “Frankenfoods.” Is this a fair way to characterize them? Do you…

A: GM (Genetically Modified) foods are crops that have had specific genes in their DNA introduced,…

Q: Gram-negative bacteria are not killed by penicillin because they:    do not have ribosomes.…

A: Bacteria can be gram-positive or gram-negative depending on how they are stained. Christian Gram…

Q: Lactose intolerance is caused by reduced production of the enzyme lactase.  A variety of digestive…

A: Lactose intolerance is a condition in which the body is unable to digest lactose, a type of sugar…

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of  DNA, it is known as transcription. Transcription is…

Q: Assisted protein folding is facilitated by a specific class of proteins called _______.

A: INTRODUCTION  Proteins are essential molecules for all living organisms, made up of amino acid…

Q: Describe the function of platelets. Multiple Choice O O Phagocytosis of pathogens and foreign debris…

A: Both humans and animals have a fluid connective tissue called blood. Transferring elements like…

Q: Nonalcoholic fatty liver disease is thought to be exacerbated by a diet heavy in sugar. Explain?

A: Introduction :- Nonalcoholic fatty liver disease (NAFLD) is a condition in which excess fat…

Q: What happens to the range of values you obtain as the number of beans in the sample increases? If…

A: As the number of the beans in a bag increases the standard deviation decreases. So if 15 bean…

Q: Are any two the same species?

A: Introduction: Bacteria are single-celled bacteria that can be found practically anywhere on Earth,…

Q: Infection with SARS-CoV-2 can result in a wide range, and severity, of symptoms. Research suggests…

A: Introduction: Genetic variation refers to differences in the DNA sequence among individuals within a…

Q: what is mitosis and how does it differ from meiosis?

A: A parent cell divides into two daughter cells during the process of cell division. The process of…

Q: Milk is a solution, containing the dissolved solutes protein and sugar (the fat does not dissolve…

A: Milk constitutes more water about 87% than any other element. The major contents are water, fat,…

Q: For each question, choose the cell drawing(s) from those labeled A to P that best meets the listed…

A: During prophase, the mitotic spindle also starts to form. Microtubules gradually build up between…

Q: Phenylketonuria (PKU) is an autosomal recessive disease that results from a defect in an enzyme that…

A: With the chemical formula C 9H11NO2, phenylalanine (Phe or F) is an essential -amino acid. It can be…

Q: Organism A and B A and C A and D B and C B and D % DNA Hybridization 5-15 5-15 70-90 10-20 2-5

A: Introduction DNA hybridization is a laboratory technique used to determine the degree of similarity…

Q: The make-up of the microbial community in the leaves of pitcher plants is affected more by the types…

A: Introduction: Adaptations refer to the characteristic features and behaviors that have evolved in a…

Q: True False Glochidia morphology (shape) Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia…

A: INTRODUCTION Rectidentinae mussels are an interesting family of bivalves, with an evolutionary…

Q: Sort the following events to reflect the order in which they should occur during vesicle docking…

A: Answer correct option (b) 3124 Vesicle have bounded Rab-GTP which interacts with Rab effector…

Q: Below is the pedigree of one form of hemophilia. Which type of hemophilia can you rule out? (You…

A: Hemophilia is a disease where blood doesn't clot normally . And due to this excessive bleeding…

Q: How does DNA bending protein relate to transcription?

A: Introduction: Binding to their recognition site, a growing number of transcription factors from…

Q: What is the genetic mechanism behind BWS and RSS in Parental imprinting?

A: A subset of genes are expressed differently depending on the parent, a phenomenon known as genomic…

Q: What came first, the ribosome or the protein?  explain in detail why

A: Ribosomes are essential components of cells, responsible for synthesizing proteins from the…

Q: 8. Which statement/s about RNA is/are true? (Select all that apply.) * RNA is made through the…

A: 8.RNA stands for ribonucleic acid.It act as a genetic material in a viruses.It also play essential…

Q: Chi-square is a statistical test comparing a set of observed data against expected data to check for…

A: Introduction  A hypothesis is a tentative explanation or prediction about a phenomenon that can be…

Q: In a certain species of plants, violet flower color (V) is dominant over white flower color (v). If…

A: This question is about the concept of dominance and recessiveness in genetics, specifically in the…

Q: 1.. What is the useful operating volume range of a Gilson P-10 pipette? Where did you find this…

A: Micropipettes are laboratory instruments used to precisely measure and dispense small quantities of…

Q: Select two of the following diseases and discuss cause, predisposing factors and identify if it is…

A: 2) Cystic fibrosis A genetic (inherited) condition known as cystic fibrosis (CF) results in the…

Q: V V V V Ecosystem service: Provisioning Ecosystem function: Flow of information Ecosystem function:…

A: Introduction  An ecosystem deals with biotic and abiotic factors and their interaction with each…

Q: Fill in the blanks The discovery that genes can move from one chromosome location to another was…

A: Introduction: A DNA sequence known as a transposable element (TE) is able to migrate, or…

Q: When you have finished examining of all the vertebrate tissue slides, fill in Table 2-2 with the…

A: An organism is made up of different types of tissues and organs. Histological studies involve the…

Q: What is the name on the diagram number 4, 5,6, 9

A: The cross-section of skin has three main layers: the epidermis, dermis, and subcutaneous tissue. The…

Q: Which can NOT be found in vessels? O a. Tyloses O b. Pits O c. O d. Resin Perforation plates

A: A vessel is a plant structure that distributes fluids such as water, sap, and nutrients from the…

Q: i don't see how the result turn out for this cross? red x kitey 18 red 9 kitey 6 black

A: Introduction  Genotypes are the genetic makeup of an organism, represented as the combination of…