Q: In an EMSA, the binding of a protein to DNAa. prevents the DNA from being digested with a…
A: Electrophoretic mobility shift assay (EMSA) is used to identify deoxyribonucleic acid (DNA)-binding…
Q: During DNA replication, as DNA unwinds it can become supercoiled causing twists that stress the…
A: DNA (deoxyribonucleic acid) is a double-stranded molecule in which the two strands wind around each…
Q: A key difference between the original Holliday model and the double-strand break model is the way…
A: Answer is c.) a heteroduplex is formed.
Q: a) The newly formed strand in daughter molecule T. b) The newly formed strand in daughter molecule…
A: During DNA Replication new DNA strand synthesis occurs in 5' to 3' direction. As per Chargaffs rule…
Q: The enzyme responsible for the joining of Okazaki fragments is a. helicase b. primase c. DNA ligase…
A: Okazaki fragments are DNA nucleotides with short sequences having approximately 150 to 200 bps (in…
Q: Draw a stretch of DNA that would code for the amino acid "lysine". Be sure you draw all the…
A: The given structure is shown below.
Q: Look at the picture carefully below and imagine inside a cell nucleus. a) encircle and name the…
A: The genetic material or DNA consists of a double helical structure with a backbone of…
Q: During DNA replication, the Okazaki fragments are Select one: O a. single-strand RNA O b. RNA-DNA…
A: Option c
Q: The technique of DNA sequencing involves performing _______________ . A) northern blotting B)…
A: DNA sequence can be determined by performing DNA sequencing method in vitro.
Q: DNA gyrasea. promotes negative supercoiling.b. relaxes positive supercoils.c. cuts DNA strands as…
A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…
Q: What would be the result if an organism’s telomerase were mutated and nonfunctional? a. No DNA…
A: A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes. It is…
Q: helps create a strand of mRNA by using DNA as a template. a. RNA polymerase b. DNA polymerase c.…
A: a.) RNA polymerase. The creation of mRNA from the DNA . This mRNA is made with RNA polymerase…
Q: The polymerase chain reaction uses Taq polymerase rather than a DNA polymerase from E. coli, because…
A: Taq polymerase is use to amply the DNA in polymerase chain reaction
Q: you performed a sanger sequencing on a particular segment of DNA. Explain at the molecular level…
A: Effect on gel profile when we either forgot to add ddNTPs Or add more ddNTPs in test tubes during…
Q: In nucleotide excision repair in E. coli, the function of the UvrA/UvrB complex is toa. detect DNA…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: Regions of DNA that are most easliy unwound have
A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA and RNA…
Q: Hairpins are formed in DNA as a result of a. sequences on the same strand that are inverted and…
A: Intra-molecular base pairing in single stranded DNA or RNA leads to the formation of stem loop…
Q: The purpose of using a washing soap in DNA extraction experiment is to O a. Lyse the cells to…
A: DNA extractions is a method to isolate DNA from the nucleus of given cell culture. The four steps of…
Q: DNA polymerase can only add nucleotides to an existing chain, so _______ is required.a. a primer b.…
A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…
Q: listed below, match each to the correct definition. Definition a. Unwinds DNA b. Relieves tension in…
A: All these enzymes help and DNA replication. DNA replication process in which exact similar…
Q: a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose…
A: Given condition: a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides. Mutation…
Q: A DNA molecule that is 1000 base pairs in length would go molecule that is 200 base pairs in length.…
A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…
Q: The dideoxynucleosides ddATP, ddTTP, ddGTP, and ddCTP were important in DNA sequencing because they…
A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors used in the Sanger technique of…
Q: helicase
A: The unwinding of DNA is a complex process. It is done during the DNA replication. It is done when…
Q: Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′…
A: Transcription is the process in which the codes in DNA are transcribed to mRNA. This helps to…
Q: DNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new…
A: DNA replication is heterocatalytic process by which a new DNA strand is synthesized on a old DNA…
Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…
A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…
Q: Propose an experiment that would test the importance of ionic strength in the determination of DNA…
A: The DNA melting point is the temperature at which DNA helices are denatured and it is referred to as…
Q: Single stranded binding protein A coats ss DNA to keep it single stranded b bind double…
A: Single-strand DNA-binding protein (SSB) is a protein found in Escherichia coli (E. coli) bacteria.…
Q: Which mechanism requires the ability to distinguish between newly synthesized and template strands…
A: DNA is the double stranded structure in which genes are located. Usually it functions as genetic…
Q: SSBS are: A single-stranded bodies called Okazaki fragments. B substrates for DNA ligases. ©…
A: The biological information flows through genes. DNA is the main genetic material of most of living…
Q: Which choice correctly differentiates DNA from RNA? CHOICES DNA RNA contain thymine A contain uracil…
A: Ìt is a molecule composed of two polyneuclotide chains that are colied around each other in a double…
Q: The elongation of the leading strand during DNA synthesis(A) progresses away from the replication…
A: DNA replication is a biological process in which two identical replicas of DNA are produced from one…
Q: The elongation of leading strand during DNA synthesis a. progresses away from the replication fork.…
A: Deoxyribonucleic acid (DNA) is a molecule consist of two polynucleotide chains that coil around each…
Q: Base analogs are mutagenic because of which characteristic? a. They produce changes in DNA…
A: Mutagens are physical, chemical, or biological agent that induces mutation by changing the gene…
Q: ake this strand of DNA and a) Transcribe it, then b) Translate it. TAC GCA GTA ACA GGC CCT ATC a)…
A:
Q: A Form B Form Handedness Diameter: A Diameter: nm A Basepairs/turn Distance between bases Distance…
A: The DNA or deoxyribonucleic acid are present in the nucleus of eukaryotic cells. DNA is the genetic…
Q: The initial mechanism for repairing nucleotide errors in DNA is ________. a. mismatch repair b. DNA…
A: The biochemical molecule that is built up with two polynucleotide chains is called DNA…
Q: A.) Damaged DNA can be reversed if nucleotides can be replaced with a proper nucleotide for a…
A: DNA repair : The DNA molecule may undergo some alternations due to various factors like exposure to…
Q: unknown coding strand of the DNA can be easily determined. G A T с ||_ |||||| | || <|||| | |_|| | ||…
A: Introduction There are two types of nucleic acids are present in our body, DNA and RNA. DNA acts as…
Q: The problem of synthesizing the lagging strand, in the sense that DNA synthesis can only occur in…
A: DNA synthesis is the formation of new DNA molecules from the parental strand by utilizing…
Q: A protein that can cut DNA at specific DNA base sequences is called a a. DNase. c. restriction…
A: A cell is that the most fundamental unit of life. Each organism's genetic material is contained in…
Q: _____ is a change in the order of one nucleotide in a section of a DNA molecule. a Point mutation b…
A: Option A is correct because a point mutation is a type of mutation in DNA or RNA, the cell's…
Q: n DNA replication, a primer is _____. a. what the original DNA strands are called b. a…
A: DNA replication is a process in which the double stranded DNA molecule is copied inorder to produce…
Q: When a dideoxyribonucleotide is incorporated into a growingDNA strand,a. the strand elongates…
A: Given: Explain when a dideoxyribonucleotide is incorporated into a growing DNA strand, choose the…
Q: The chain termination method of sequencing: a. uses labeled ddNTPs b. uses only dideoxynucleotides…
A: DNA is a nucleic acid present in living cells.
Q: The rate of migration of DNA within an agarose gel in the gel electrophoresis technique is dependent…
A: Agarose gel electrophoresis: It is used for the separation of DNA molecules that are larger than…
Q: You want to propagate large amounts of a DNA fragment. To do this, use a plasmid vector. a) How…
A: a) DNA cloning is a technique that makes many identical copies of a piece of DNA, such as a gene. In…
Q: (a) Write the DNA double strand. (b) Assuming the gel pattern represents the template strand,…
A: The sequence from the gel is read from the bottom of the gel to the top. And as given Gel contains…
Which protein or enzyme represents "Single Stranded DNA Binding Proteins"a.
A
b.
B
c.
C
d.
D
e.
E
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which forward are reverse primers will amplify the following sequence by PCR? 5' GACCTCGCCGACGCCCTCGACCAGCTCCTGCGCCGCACCCGCCACCTCGCCGAGACC GAGCAGAAAACCCGCCGTCGGAGAGCCACCCGCTCCGGTACGGCAGCACAGTTGCCCGA TCTTCCAGGCCAGCGGCGCCCATTCGACGCAGAGACCGCACCGGCCCCGGCACCGGACT GGAGCGAGAGCCTGGACGACCTCATCAGCGTCGACACGGCGGCCCAGACCGGCACGAGC GAGATGGAGGGCGCGAGCGTGCCGCCGGCCGAGGCAGGCGGGTACGGGCTGTGGGACGC CGAAGCGGAAGCCGAGCAATGGTGAACGCCTCACCGGGCACGAGCGATACGCCGGG 3'Which of the ff is incorrect?Person and blood Type Probable Genotype Possible Gametes Mrs. Simons------A + IAIA + -, IAi + Mr. Simons-------A - IAIA -, IAi - Mrs. Simple------A + IAIA + -, IAi + Mr. Simple------- B + IBIB + -, IBi + Mrs. Simpson----B - IBIB -, IBi - Mr. Simpson-----O + Ii + - Baby A-------------B - IBIB -, IBi - Baby B-------------O + Ii + - Baby C-------------AB - IAIB - I just need help for possible gametes.
- TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .wol for Frayon Elolog - Meet - cha-gX-m sc Jupiter Ed G Which orgerell= A sample of DNA is collected from an organism. It is analyzed and determined that 20% of the DNA is made up of the base adenine. Based on this information, which of the following correctly lists the amounts of the three. remaining bases for this sample? 10% cytosine, 30% thymine, 40% guanine O 20% cytosine, 20% thymine, 20% guanine 30% cytosine, 30% thymine, 20% guanine 30% cytosine, 20% thymine, 30% guanine p. 5 of 31
- Lay out the genetics of Nicholas’s case, including where the mutationoccurred, what exact nucleotide defect was present, why this was aserious type of defect, and why he was so affected by the mutationbut his mother was not.ersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ONposition position (5' end) position (3' end) UUU Phe - F UUC Phe UAU Tyr Y. UAC Tyr UAA Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser U UUA Leu UUG Leu UCA Ser UCG Ser UAG Stop W 輔 CAU His CGU Arg CGC Arg CGA Arg CGG Arg CUU Leu CCU Pro CUC Leu CCC Pro P. CCA Pro CÁC His CỦA Leu CAA Gln CUG Leu CCG Pro CAG GIn AUU lle ACU Thr AAU Asn AGU Ser AUC lle ACC Thr -T ACA Thr AAC Asn_ AGC Ser AGA Arg AGG Arg A AUA lle AAA Lys EK AAG Lys AUG Met ACG Thr GUU Val GGU Gly GGC Gly GGA Gly GGG Gly GAU Asp D GAC Asp GCU Ala GUC Val -V GUA Val GCC Ala GCA Ala GCG Ala G - A GAA Glu FE GAG Glu GUG Val Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider the DNA sequence–3'-CACTGGTAGCGA–5', • What is the sequence of the messenger RNA sequence that is transcribed from this DNA sequence? (Indicate the 5' and 3' ends of the RNA molecule.) • Consult the genetic code that is shown above. What is the amino acid sequence of the…
- Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?a) what si the nucleotide at the 5 prime end of the picture? b) what si the DNA sequence from 5 prime to 3 prime pls help, urgently required, no explanation neededQUESTION FROM GENETICS।। THANKS