Q: What is the relationship of evolution and human behavior?
A: The evolution and human behaviour are related to each other. Evolution occur due to natural selectio...
Q: What is the importance of ecosystem services and what are the benefits does the biodiversity gets in...
A: Ecosystem services and their sustainable use is very essential.
Q: Red–green color blindness is an X-linked recessive disorder in humans. Your friend is the daughter o...
A: Introduction Probability is a statistical tool in genetics that lets us anticipate the likelihood of...
Q: F1
A: Phenotype-the ratio of offspring manifesting a particular trait. F1-the first flial generation seeds...
Q: To ensure easier focusing, what should be done first before the HPO is swung into position?
A: High power objective lens is used to examine fine details of the given specimen. The total magnifica...
Q: Determine which of the following passages are arguments. For those that are, identify the conclusio...
A: Note- As we are allowed to answer only one question at a time. I will provide answer for only first ...
Q: Describe Mendel’s principles of segregation and independent assortment.
A: Mendel studied seven characters of the pea plant, Pisum sativum. Based on his findings he proposed p...
Q: Name and describe the idea that explains how mitochondria and chloroplasts are thought to have origi...
A: Photosynthesis is the process through which green plants and some organisms use sunshine to convert ...
Q: life history patterns and how different
A: Life history-A history of the changes through which an organism passes in its development from the p...
Q: Hardosaurs like edmontosaur the front feet do they have name or description how they look? It looks ...
A: The comb-crested hadrosaurid (duck-billed) dinosaur Edmontosaurus regalis is a species of comb-crest...
Q: Describe and explain the necessary changes that health systems worldwide must undergo to improve ada...
A: Introduction :- Healthcare system is a system consisting of institutions ( like hospitals, dispensar...
Q: Refer to question 5. Assuming complete dominance, the F2 generation will show a phenotypic ratio of_...
A: Complete dominance: Diploid organisms frequently carry two alleles of a gene in the most extreme cir...
Q: 3. Describe the effect of malaria on the frequency of the Hbs allele in areas where is common in are...
A: Sickle cell anaemia results in the single amino acid change in the beta chain of globin protein that...
Q: The lumbar region is ________.a. inferior to the gluteal regionb. inferior to the umbilical regionc....
A: Vertebrae of a human spine is divided into cervical, thoracic, lumbar, sacral and coccygeal. Out of ...
Q: eries of steps rat nuch to capture in s than would be r chan would be rel
A: The less total energy is released in multiple steps than would be released in a single step. Only a ...
Q: Helping tags; biology, food, scientists What topic may have been developed to address food safety i...
A: According to me the best pair of scientists amongst the given options is that of Anton Van Leeuwenho...
Q: Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as dep...
A: Post-traumatic stress disorder is one of the serious and rare disease. In this disease mental and be...
Q: Enumerate 5 important features of the DNA. Choose ONE from your list and elaborate on how this feat...
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and...
Q: The drug butenamide blocks the co-transporters for Na+ and Cl- in the ascending limb of the loop of ...
A: The drug butenamide is a loop diuretic whose main function is to block the Na+ k+ 2cl- co transport...
Q: Which of the following is an example of allosteric regulation? A. the binding of CAMP-CAP to DNA B. ...
A: Allosteric regulation is a form of regulation where enzymes or molecules are regulated by binding to...
Q: QUESTION 1 Ion pumps.. DA Use the energy of ATP hydrolysis to move ions against their concentration ...
A: Ion pumps use energy from ATP hydrolysis to transport ion against the concentration gradient. They c...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A:
Q: Assume that the ratio of females to males is 1:1. A couple already has two daughters and no sons. If...
A: Introduction Probability is a statistical tool in genetics that lets us anticipate the likelihood of...
Q: 1) What makes the heart sounds? 2) Know the whole cycle/route that the blood takes from the heart th...
A: 1.Blood does not pass back from the atria into the great veins because the roots of great veins are ...
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...
Q: nucleoid ribosomes plasma membrane flagella lysosome mitochondria nucleolus prokaryotic only eukaryo...
A: Prokaryotic and eukaryotic cell share few similarities however show so many difference in their stru...
Q: Inversion heterozygosity occurs in organisms with one inverted chromosome and one noninverted homolo...
A: Paracentric inversion does not include centromere.
Q: Distinguish among inducible, repressible, and constitutive gene operons.
A: An operon is a cluster of functionally-related genes that are controlled by a shared operator, it is...
Q: Using penci, you will draw a representation of DNA replication along the leading and lagging strands...
A: Replication is the process by which DNA duplicate and make its own copies, replication of DNA is a l...
Q: Describe how DNA moves from cell to cell by: a. conjugation b. transduction c. transformation
A: A bacterium takes a fragment of DNA drifting in its surroundings during transformation.A virus unint...
Q: What is transpiration
A: A complex traffic material is moving in different directions in a flowering plant, with each organ r...
Q: (a) Gryllus pennsylvanicus prefers sandy soil. (b) Gryllus firmus prefers loamy soil. Based on the i...
A: Geographic, behavioural, physiologic, or genomic obstacles or differences that prevent a species fro...
Q: Why did we add agar after we measure the pH?
A: pH means p stands for potential or power.H stands for Hydrogen atom.It is the power of the Hydrogen ...
Q: Describe alleles and why they occur on homologous chromosomesof sexual reproducers
A: The term "chromosome" is derived from the Greek word for "color (chroma) and body (soma)." Thread-li...
Q: As energy passes from blue-absorbing chlorophylls down to red-absorbing chlorophylls, surprisingly, ...
A: The process of photosynthesis involves the absorption of sunlight by photosynthetic pigments. There ...
Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans: TTACACTTGCTTGAGAGT...
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for you...
Q: Create a flow chart on how to prepare a nutrient agar
A: Nutrient Agar ...
Q: In plants, the transition from water to land most likely happened once twice: ones in the moss linea...
A: The difficulties that the primary land plants needed to defeat going limp in land from gravity, the ...
Q: A 42-year-old woman consults a dermatologist to evaluate and treat her glabellar lines (frown lines ...
A: The correct answer from the above option is option A.
Q: Name 10 cell parts and mark check (/) if present; mark cross (X) if absent. Example: Eukaryotic Euka...
A: Cell parts with their absence or presence in eukaryotic /prokaryotic cell or virus are given in foll...
Q: Predict or describe the absorbance or enzyme activity at: pH = 2 pH = 14 Explain your predi...
A: The single most crucial asset of enzymes is the ability to increase the rates of reactions going on ...
Q: What is a selective sweep? O When a beneficial mutation is lost due to genetic drift. O When a benef...
A: Certain terms are fundamental concepts in biology, the study of living organisms. Theses terms are s...
Q: What property of the various cytochromes ensures unidirectional electron flow along the electron-tra...
A: Cytochromes, a family of metalloproteins which performs one-electron transfer reactions, in biologic...
Q: B. Female (Swine) 12 10 Urinary Bladder 13 Urinary Bladder 15 14 13
A: 9) Ovary 10) Oviduct 11) Uterine horn
Q: How does the translated mRNA convert into a functional protein?
A: Translation is a process in which cells make the proteins.
Q: Acetic acid (a weak acid with a pKa of 4.75) and ethanol (an alcohol) are each composed of two carbo...
A: The plasma membrane is primarily composed of lipids. These are made up of fatty acids and glycerol. ...
Q: Maximal production of ATP from glucose involves the reactions of glycolysis, the citric acid cycle, ...
A: Cellular respiration is the process by which organisms utilize oxygen to break down complex food mol...
Q: Remember that although there are many interesting ideas about genetic engineering of plants and anim...
A: Transgenic bacteria are bacteria whose genome contains genes from other organisms that have been del...
Q: Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as dep...
A: The diagnosis of the disease is very important in medical science. It helps in proper treatment and ...
Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...
A: DNA is stands for Deoxyribonucleic acid.It is a genetical material present in all peoples.Every pers...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following is not a member of the phylum Chordata? a. Cephalochordata b. Echinodermata c. Urochordata d. VertebrataAll of the following are clades of amphibians EXCEPT Urodela Apoda Tuataras Anura OOOWhich of the following structures are analogous? Cat legs: Dog legs Penguin fin: Pigeon wing Insect hairs: human hairs Crab mandible: scorpion chelicerae
- Which of the following is NOT a tetrapod? Group of answer choices Lungfish Snake Legless lizard Chicken HumanWhich statement below is false given the tree below? Pisces Osteichthyes (bony fishes) Sarcopterygi (lobe-finned fishes) Cyclostomata EAgnatha) Tetrapoda Amniota Reptilia O All reptiles (members of Reptilia) are amniotes (members of Amniota) O All reptiles (members of Reptilia) are tetrapods (members of Tetrapoda) O All amniotes (members of Amniota) are tetrapods (members of Tetrapoda) O All amniotes (members of Amniota) are reptiles (members of Reptilia) Mixini (hagfishes) Petromizontida (lampreys) Chondrichthyes (cartilaginous fishes) Actinopterygii (ray-finned fishes) Actinistia (coelacanths) Dipnoi (lungfishes) Amphibia Mammalia Non-avian reptiles AvesMouth This animal could be described as . Select all that apply. a Cnidarian having no symmetry a medusa having radial symmetry polyp
- Which of these is not a feature of amphibians?a. dry skin that resists desiccationb. metamorphosis from a swimming form to a land formc. small lungs and a supplemental means of gas exchanged. reproduction in the watere. a single ventricleOf the following, which includes chordates that are NOT vertebrates? Myxini Echinodermata Gnathostomes UrochordataWhich of the following animals has a hydraulic skeleton?a. crustaceanb. sea urchinc. sea stard. jellyfish
- Which of the following are amniotes? Choose all that apply. Fish O Amphibians O Reptiles Birds MammalsYou find a dead animal on the side of the road and are trying to identify it. After externally observing and dissecting it, you can see that it has four legs with sprawling posture, a long tail, a faveolar lung, a heart with one ventricle and a hemipenes. Based on your observations, which of the following statements below is TRUE? This is a Tuatara This is an amphibian It is impossible to know the group of this animal without seeing the number of temporal fenestrae in the skull This is a synapsid This is a squamateYou believe that an adult animal you are examining is a vertebrate but concede that it may be an invertebrate chordate. Which of the following would ensure that you are indeed looking at a vertebrate? OIt lacks a notochord. It has a dorsal hollow nerve cord. It uses its pharyngeal gill slits for respiration. Its notochord functions as an endoskeleton. It is able to swim.