Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 Residue Number 2 Hydropathy value 02-+- 5 15
Q: Discuss the synthesis and breakdown of glycogen and how the processes are regulated in response xto…
A: Glycogen is a homopolysaccharide. glycogen has α1-4 glycosidic bond in linear eight to ten…
Q: Consider the fatty acids: (a) Arachidic acid (C20H40O2); molar mass = 312.5 g/mol) (b) Palmitoleic…
A: β-oxidation generally occurs in the mitochondria, and it is the pathway for degradation of fatty…
Q: The number of CO2 molecules liberated for each molecule of acetyl-CoA during oxidative…
A: The tricarboxylic acid cycle also called a citric acid cycle or Krebs cycle is the second stage of…
Q: A heptapeptide was analyzed by Pinky. She reacted it with carboxypeptidase and found out that it…
A: Protein sequencing is the method used for determining the amino acid sequence or the primary…
Q: With which of the four complexes in the electron t ransport chains is each of the following events…
A: The electron transport chain receives the NADH and FADH2 generated in the citric acid cycle. The…
Q: If there is an accumulation of acetyl CoA in the liver mitochondria, acetyl CoA is converted to…
A: Acetyl-CoA is formed from the end product of glycolysis i.e. pyruvate and then participates in TCA…
Q: If a compound has strong IMFs it will... 1. have a high MP/BP 2. have a low MP/BP 3. MP/BP are…
A: Introduction: Intermolecular forces (IMFs) are the attractive forces between molecules, between…
Q: Which of the following is MOST soluble in polar solvents? A H3C LOH В с D В OD Oc О А H3C. HO л HC…
A: In the given image, structures A, B, and C represents fatty acids. A is a saturated fatty acid.…
Q: A buffer system consists of A. a weak acid and its conjugate base. B. a weak acid and a proton…
A: A buffer is a aqueous solution which is used to resist the pH change upon addition of acid or base.…
Q: Which abbreviation is this following peptide? GKH QGR HK GHK GHL
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′…
A: The capping of mRNA is a mechanism that prevents the mRNA strand from being degraded by exonucleases…
Q: Dissipation of the proton gradient is required for Formation of ATP from ADP+Pi…
A: As during electron transport chain, the proton gradient created by proton pumping is utilised to…
Q: please calculate the unknown concentration of the protein A wih an absorbance value of A188 given…
A: Absorbance = -log (I / Io) where I is intensity of transmitted light and Io intensity if incident…
Q: The resulting molecule(s) during the investment phase of Glycolysis. The substrate that is not…
A: Introduction: The glycolysis pathway involves a series of ten enzyme-catalyzed reactions that…
Q: Statement A hexose sugar Insoluble in water Formed by condensation reactions Contain the elements,…
A: The biological macromolecules nucleic acids, proteins carbohydrates and lipids form the building…
Q: 2. (a) List the number of NADH and FADH2 equivalents formed and the corresponding number of ATP…
A: The fatty acid with 14 C is called myristic acid. Beta oxidation involves the sequential removal of…
Q: What is the pI, and how is it determined for amino acids that have noninionizable R groups?
A: pI is the isoelectric point at which no net charge on a molecule.
Q: A GRK inhibitor would have what effect on GPCR inactivation in the presence of a GPCR agonist? (a)…
A: Agonists are substances which mimic the activity of a ligand. The activation of the GPCR triggers a…
Q: Define and simplify each of the words meaning in your own words. amino acid transporter:…
A: Introduction: Amino acids are molecules that contain an amine group, a carboxylic acid group, and a…
Q: What are the application of human genome(not human genome project) into health, biochemistry, and…
A: Human genome comprises of human's nucleic acid sequences that are encoded only in form of DNA. This…
Q: 5. Dipeptide a. Draw a dipeptide with one polar amino acid connected to one nonpolar amino acid b.…
A: Peptides and polypeptides are linear polymers made up of amino acids. A dipeptide is composed of two…
Q: Which of the following is not an inhibitor? a. CO b. Magnesium ion c. sulfa drugs d. cyanide e.…
A: Introduction: Inhibitors are compounds that reduce the rate of chemical reactions. It can also act…
Q: Consider the carbohydrate maltose. a. How many molecules of acetyl CoA are formed from its complete…
A: Maltase is the enzyme that transforms maltose into glucose. During digestion, pancreatic or salivary…
Q: I. REGULATION OF METABOLIC PATHWAYS Indicate what will happen (increase, decrease or no effect) to…
A: Phosphofructokinase catalyzes the important "committed" step in the process of glycolysis. Pyruvate…
Q: Consider fatty acids from the hydrolysis of the given TAG in a liver cell where amino acid and…
A: Fatty acid oxidation is the process in which long chain fatty acids are converted into acetyl-CoA.…
Q: 10. Why would it be inaccurate to say that solution that maintains a constant pH? KU a buffer is a
A: The pH of blood is approximately 7.4, which is somewhat basic. This pH fluctuates by less than a…
Q: Tumor cells often lack an extensive capillary network and must function under conditions of limited…
A: Tumor cells show uncontrolled growth. Tumor cells do not differentiate into various types of cells.…
Q: Which of the following is NOT an isoprene-derived lipid? Beta-carotene Beeswax…
A: Lipids are amphipathic molecules. Amphipathic molecules contain the polar head and non-polar or…
Q: What is the relationship between Warburg effect and oncogenesis? Explain why cancer cells have…
A: As a result of overexpression of numerous main glycolytic enzymes, the Warburg effect is linked to…
Q: Which of the following is NOT a light-harvesting pigment? Group of answer choices: chlorophyll a…
A: The light-harvesting complex is an arrangement of protein as well as chlorophyll molecules. They are…
Q: II. Provide the chemical formula for each of the following compounds. 6. copper (II) sulfite 7.…
A: Chemical formulae are a way to represent any chemical compound using the symbols for the components…
Q: 45. find the connection among the words below and choose the letter of the word which is different…
A: Gel electrophoresis is a technique used to identify, quantify, and separate nucleic acids. The…
Q: Which of the following statement(s) is/are TRUE about ketogenesis? I. It is favored during a low…
A: Ketogenesis means the synthesis of keto-acids in the human body. Ketoacids are synthesized in the…
Q: Explain what is meant by "The Central Dogma"? In your explanation, describe the structure and…
A: DNA acts as the carrier of genetic information from one generation to the other. Hence it is…
Q: For each fatty acid given, determine the following. Gross ATP from b-oxidation cycles Gross ATP…
A: Since you have posted a question with multiple subparts, we will solve the first three sub-parts for…
Q: A hamster receives a dose of 3 mg. of a compound and then 2/3 as much as the previous dose at the…
A: Regardless of the reason for administration, drug dosing must be safe and effective. Allometric…
Q: What role do aurora kinase play in the cell cycle and how would using these kinases as target for…
A: A particular series of events undertaken in proper time frame inside different types of cells when…
Q: Which of the following is the densest TAG? Otrimyristin triolein O tristearin Otripaltristearin…
A: In biochemistry, TAG stands for triacylglycerols. These are referred to as the crucial components of…
Q: We saw that GPCRs have a basal level of constitutive activity. Not all receptors do. Why might…
A: Introduction: G-protein coupled receptors (GPCRs) are also known as seven-membrane domain…
Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA…
A: Central dogma includes three main processes Replication, Transcription, and Translation.…
Q: Label the x axis in each graph below with the appropriate factor (possible factors: temperature, pH,…
A: Introduction: Enzymes are proteins that function as biological catalysts to accelerate the rate of…
Q: The Hell-Volhard Zelinsky reaction produces a product required for amino acid synthesis. True or…
A: Amino acids are compounds that contain alpha-amino and alpha-carboxylate functional groups together…
Q: How do RNA and DNA differ?
A: Of the four kinds of biological macromolecules, DNA and RNA fall under the category of nucleic…
Q: How can a mass spectrometer be used to identify the protein/s excised from a 2D gel?
A: Mass spectrometry (MS) is an analytical technique that is used to measure the mass-to-charge ratio…
Q: What is the complete base composition of a double stranded eukaryotic DNA that contains 24%…
A: DNA is a nucleic acid that is composed of nucleotide units. Each nucleotide unit is composed of a…
Q: briefly explain the importance of the degeneracy of the genetic code in the translation process.
A: The genetic code can be defined as a collection of rules that living cells use to translate…
Q: 3. Draw the structure of a protein containing 3 amino acids and then explain the process of…
A: Proteins are a class of complex macromolecules essential for the human body. Proteins are formed by…
Q: Consider the following diagram of the cell membrane. Which of the statements is NOT true regarding…
A: The fluid mosaic model of the cell membrane describes the plasma membrane to be a mosaic of…
Q: Name of the vitamin source of CoASH A. B12 B. B3 C. B9 D.B1 E. B7
A: Some enzymes are dependent on cofactors for their enzymatic activity. There are two types of…
Q: A water (H20) molecules is
A: Water occurs as a liquid on the Earth's surface under normal conditions, making it invaluable for…
Step by step
Solved in 2 steps with 1 images
- Which of the peptide sequences below best matches the hydropathy plot shown? L 10 Residue Number 4 2 Hydropathy value -2 0 セー RAFLILFMTYFLILFLI ILYYAGSREDHSGYLIL OLHGDQNRERDGHSQERD EQSDTERNQHGALIYLI 01 5 152q Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 Residue Number RAFLILFMTYFLILFLI ILYYAGSREDHSGYLIL LHGDQNRERDGHSQERD EQSDTERNQHGALIYLI 3q Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 Residue Number Hydropathy value -4 -2 0 2 4 Hydropathy value -4 -2 ILYYAGSREDHSGYLIL EQSDTERNQHGALIYLI LIFLAIFPAGSTSEDRR RAFLILFMTYFLILFLI L 15 15What is the expected molecular weight of the protein encoded by the sequence provided here: ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGTAGGTGCACTTGGTGATGTGAGTCTGGGCTGA
- The peptide below -NH-CH- H3N-CH- CH3 NH-CH- -NH-CH- -O- -NH-ÇH- CH2 CH2 CH2 HN-ç=NH, NH2 CH2 CH2 CH Ho-CH, C-OH H,C CH3 needs to be separated from a second peptide with a primary sequence ADES. At what pH range would it be possible to separate the peptides? O 0- 2.0 O 2.5 - 3.5 O 4.0 - 9.0 O 13.0 -14.0 о 10.0-12.0Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.The estimated size of fusion protein of an antibiotic (540bp) and an anti-inflammatory agent (630 bp). There are an additional 222 bp between the sequences. Assuming the average weight of an amino acid is 114 Da, what is the estimated size of the fusion protein? 53 kDa 44 kDa 59 kDa 159 kDa
- The sequence of a 29 aa long peptide can be determined from the following data: Treatment of the peptide with dansyl chloride reveals that the amino-terminal is Val. Trypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: T-1 V-G-A-H-A-G-E-Y-G-A-E-A-T-E T-2 A-A-W-G-KT-3 V-L-S-P-A-K T-4 T-N-V-KLow-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-Gly-Ser-Gly-Ala-Gly-Ala-)n, where n indicates any number of repeats, shows an extended structure of stacked layers, with a repeat distance between layers that alternates between 3.5 Å and 5.7 Å. Propose a model that explains this scenario.With, Asp-Cys-Lys-Arg What are the pH buffering regions (pH range)? What is the charge at ph 4? Please explain how you find this out. Thanks!
- What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-Calculate the pI for the following tri-peptide: Glu-Arg-LysThe globular proteins tend to have a high-dimensional folding in their higher-order structure g providing very limited analysis when conducting peptide analysis. Explain what steps would be suitable to prepare a successful chromatographic peptide mapping?