Which of the following statements about the processes of the central dogma is/are incorrect? I. Replication occurs only once during the life cycle of a cell. II. The entire sequence of a DNA molecule carries instructions for the synthesis of proteins and nucleic acids. II. The products of transcription all eventually undergo translation. IV. Transcription and replication both involve the use of RNA molecules. V. The translation of the genetic code is directly based on the sequence of the template DNA strand.
Q: Messenger RNA is formed by translation of a gene on the DNA template strand.True or false?
A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…
Q: Below is a list of functions related to protein synthesis. Place the number for the function in the…
A: The production of RNA from the DNA is known as the transcription process that occurs within the…
Q: What is the direction of RNA synthesis? Is it the same as DNA replication? How does RNA…
A: Asked : Direction of RNA synthesis,DNA replication and RNA transcription end process
Q: Which enzymes are involved in protein translation? There are multiple answers. Helicase DNA…
A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…
Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…
A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…
Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…
A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…
Q: Compare the process of Replication, Transcription, and Translation by describing the following…
A: In the molecular biology, the genetic information is encoded in the DNA. Central dogma consists of…
Q: Which of the following is NOT correct regarding DNA and RNA synthesis? Select one: a. The overall…
A: Replication is the process by which, DNA is copied. Where transcription is the process by which DNA…
Q: Explain what semiconservative means with respect to DNA replication.
A: The replication of DNA is semiconservative in nature as every new strand of DNA double helix is…
Q: How would you make a copy of DNA from an mRNA transcript and what is this molecule called?
A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…
Q: Which of the following statements BEST describes the process of DNA Replication? Group of answer…
A: To answer this question, each option is analysed as follows and final conclusion is drawn in step 2.…
Q: Refer to the double stranded DNA molecule with the sequence below to answer the following questions:…
A: The process of conversion of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) is called…
Q: Which of the following statements is false of ligase? Ligase is specific to leading strand…
A: DNA ligase is a specific type of enzyme, that facilitates the joining of DNA strands together by…
Q: Which of the following processes is a part of protein synthesis and is NOT affected by a silent…
A: Introduction DNA is a self replicating molecule. During DNA replication each strand of DNA acts as a…
Q: The building blocks that form the DNA double helix are called Multiple Choice nucleoli.…
A: In eukaryotic cells, the nucleolus is the biggest nuclear organelle and the principal site of…
Q: Identify three ways transcription is different from replication.
A: Transcription: The formation of RNA take place from the template strand DNA. It occurs to form RNA…
Q: Which of the following statements is TRUE? O DNA polymerase moves in a 5 to 3 direction in…
A: In this question, we have to identify the statement that is true.
Q: Each of the following statements about protein synthesis is false.Correct each to make a true…
A: Nucleotides are the monomers of nucleic acids, DNA and RNA. A nucleotide is composed of a…
Q: In the diagram below (Figure 22), fill in the terms in the appropriate places indicated by a letter.…
A: This represents central dogma of molecular biology. It shows the flow of genetic information from…
Q: Compare and contrast the processes of transcription and translation
A: Deoxyribonucleic acid (DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Which of the following represents the correct sequence of steps that occur in protein synthesis?…
A: Protein synthesis represents the major route of disposal of amino acids.Amino acids are activated by…
Q: DNA is directly involved as a template in the following processes, except _________. a. mutation b.…
A: Deoxyribonucleic acid, or DNA. It includes units known as nucleotides, which are biological building…
Q: . Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling…
A: The answer of the following question is given below.
Q: You see that a piece of DNA is being copied. But you cannot tell if this an example of DNA…
A: DNA replication is a process that makes multiple copies of particular DNA fragments so that they can…
Q: In comparing DNA replication with RNA transcription in the same cell, which of the following is true…
A: ANSWER;- e) The entire template molecule is represented in the product.
Q: Which of the following best describes the role of RNA polymerase in a cell? O A. It initiates…
A: DNA ( Deoxyribonucleic acid ) is a genetic material which is two stranded structure that helps in…
Q: n protein synthesis, why is it call translation? What is transcription and what does it do? What is…
A: Gene expression or protein synthesis involves two process transcription and translation.
Q: Which process in protein synthesis is most affected by a silent mutation? Select one: a. Replication…
A: Silent mutation are essentially base replacements that outcome in no difference in the amino acid or…
Q: tabulate 2 differences between DNA replication, the process of trancsription and translation…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Name differences between replication and transcription.
A: Answer 1: Replication- Replication is the process of producing two identical copies of DNA from the…
Q: The transcription enzyme that catalyzes a strand of RNA from a DNA template is called what?
A: A gene is an area of DNA molecule or polymer of amino acid that encodes function. A chromosome…
Q: Which of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur…
A: Genetic material may consist of a single gene, a segment or set of genes, or the complete genome. It…
Q: Just prior to DNA replication the cytosine in the sequence GTTCATTG is deaminated and it is not…
A: The deamination means removal of the amino group (-NH2) from a particular molecule. In the cell…
Q: How would you explain the three steps of DNA transcription
A: RNA strands are formed from the DNA strands by transcription. DNA strand contains the…
Q: Which of the following statements is/are TRUE about DNA repair? Question 24 options: Ensure…
A: DNA repair It is a collection of processes by which a cell identifies and corrects damage to the…
Q: Which of the following statements are NOT true? A. Replication is the process of making DNA and…
A: During protein synthesis, translation is the method of transforming the sequence of a messenger RNA…
Q: . Which of the following statements best describe the mismatch repair pathway?a. It is part of the…
A: DNA polymerases include a group of enzymes that are responsible for the synthesis of DNA during DNA…
Q: Which of the following statements best summarizes the differences between DNA and RNA? A) DNA is…
A: There are two main types of genetic materials: DNA RNA
Q: E. coli would be a good model organism for which of the following processes? a) DNA replication…
A: Many biological processes need a model organism to study them. As such process stand true for all…
Q: 1. Explain how DNA encodes genetic information. 2. Explain the role of complementary base pairing in…
A: Explain how DNA encodes genetic information The arrangement, or sequence, of the nucleotides along…
Q: Following transcription, the RNA has a complementary sequence of which of the following? Question 9…
A: The process of copying of DNA segment onto an RNA using enzymes and nucleotides is called as…
Q: Explain the process of Transcription and Translation. List three antibiotics and explain how these…
A: All the genetic information needed by the cell to perform its activities is encoded and stored in…
Q: Compare the process of Replication, Transcription, and Translation by describing the following…
A: DNA is genetic material in most of the organism . It carries genetic information which is required…
Q: Which two of the following statements about transcription are true A. Transcription makes an RNA…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Compare and contrast DNA replication to transcription. Include required molecular components and…
A: Gene expression is the process by which the instructions in the DNA molecule are converted to…
Q: Transcription and translation both involve an initiation, elongation, and termination phase.…
A: Answer (1) :- Fragments of DNA that are responsible for different traits are known as genes. The…
Q: Contrast DNA replication with gene expression (transcription -> translation).
A: The central dogma of the molecular biology says that the process of formation of a functional…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Outline the major steps in the process of (indicate necessary enzymes for each): a. Replication b. Transcription c. TranslationErrors can occur in any of these processes when an incorrect nucleotide or amino acid is added during synthesis of a macromolecule. In which process (Replication, Transcription or Translation) would such an error have the greatest, long-term effect? Why?Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide
- Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide a. I only b. II only c. I and IV d. III and IVWhich of the following processes is a part of protein synthesis and is NOT affected by a silent mutation? a. synapsis b. Transcription c. Translation d. ReplicationHydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.
- determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acids 5. the discussion of the entire procedurenew DNA molecule is precisely synthesized during the following EXCEPT? A.Trasformation B. Transcription C.Translation D.ReplicationBelow is a list of functions related to protein synthesis. Place the number for the function in the blank above its corresponding structure. 1. Copies the genetic code from DNA and carries it to the ribosomes 2. Splits DNA into two strands and transcribes mRNA from the antisense strand 3. Carries amino acids to the ribosome 4. Area on DNA antisense strand that RNA polymerase binds to begin transcription Answer Answer Answer Answer Promoter region mRNA RNA polymerase tRNA
- (b) (c) Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3-TAC CGG TTG TGA AGC TGA ATC-5' Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. (i) (ii) (iii) (iv) Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. Specify which of the point mutations identified in (d) are redundant? For the given tRNA for Thrombin (Thr) write down all…Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsSpecific amino acids attached to molecules of tRNA, while antocodons align with codons of mRNA describes, in part a.replication b.transcription c.translation d.recombinant DNA formation e.cellular activation