Which of the following statement is true? * Restriction enzyme binds to non-cognate DNA better than cognate DNA Carbonic anhydrase functions the best at pH7 Zinc increases the pka of water Restriction enzyme inverts the stereochemistry, suggesting that the mechanism is a direct hydrolysis Across protease mechanisms, histidine generally acts as the nucleophile In the catalytic mechanism of serine protease, the product released after the second tetrahedral intermediate is the amine side of peptide 1/1

Which of the following statement is true? * Restriction enzyme binds to non-cognate DNA better than cognate DNA Carbonic anhydrase functions the best at pH7 Zinc increases the pka of water Restriction enzyme inverts the stereochemistry, suggesting that the mechanism is a direct hydrolysis Across protease mechanisms, histidine generally acts as the nucleophile In the catalytic mechanism of serine protease, the product released after the second tetrahedral intermediate is the amine side of peptide 1/1

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 1DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

Arial BIUA 11 + .. | I 1 I 3 I 4 i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ Inone +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z** Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z** is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why? MacBook Air 000
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
In E. coli, Base excision repair (BER) handles non-bulky lesions (e.g., deamination, oxidation) and nucleotide excision repair (NER) handles bulky lesions (e.g., Py dimers). Is this statement true or false? O True False
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response
Coumarins and quinolones are two classes of drugs that inhibitbacterial growth by directly inhibiting DNA gyrase. Discuss tworeasons why inhibiting DNA gyrase also inhibits bacterial growth
Choose the correct option for following three mcqs 7.The first step in the capping reaction is catalyzed by: Phosphatase Guanylyl transferase Methyl transferase Kinase None of the above 8.Which of the following statements about tRNAs is FALSE? They contain an anti-codon loop They contain several modified bases Their secondary structure looks like a cloverleaf They are generally less then 100 nucleotides in length They are synthesized by RNA polymerase-II 9.During protein synthesis _____ delivers the charged tRNA to the A-site. EF-Tu EF-G eIF-2 RF1 RF2