Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome?Complementary mRNAResulting Amino AcidRowABD.OC. CD. DCSelect one:OA AOB BMutated DNAATGATGACTACTMetabolic syndrome is a genetic disorder with symptoms such as hypertension,elevated blood cholesterol, and low blood magnesium concentrations. Thissyndrome is caused by a mutation in which a cytosine nucleotide in the codonACG is replaced by a thymine nucleotide.Use the following to answer the nextAUGUACACUUGAMethionineTyrosineThreonineStop

DNA (Deoxyribonucleic Acid):DNA is a molecule that contains the genetic instructions necessary for…

Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Row A B C D. OB. B D c. c D. D Select one: OA A Mutated DNA ATG ATG ACT ACT AUG UAC ACU UGA Resulting Amino Acid Methionine Tyrosine Threonine Stop

Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Row A B C D. OB. B D c. c D. D Select one: OA A Mutated DNA ATG ATG ACT ACT AUG UAC ACU UGA Resulting Amino Acid Methionine Tyrosine Threonine Stop

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
Iv been marked with 3 wrong answers for this problem. please help me identify my mistake. I understand mrna initiates but when in order of trna and rrna im a bit confused...
Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТ Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: ATG CGC TCC CAT CTT AAC CAA AGA GGT TGG CTA TTT T Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- missense nonsense antisense O frame-shift silent
a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of impact will this mutation have on the functionality of the protein? Second Letter UAU Tyr UAC UUU UCU UGU UGC Phe Cys C UUC UUA UUG UCC UCA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G Leu UCG CGU CAU His CCU C CCA G CUU CUC CAC CGC Leu CUA Arg Pro CGA CGG CAA Gin CUG CAG AUU AUC lle AUA AUG Met ACG ACU ACC ACA AAU Asn AAC The AAA AGU AGC Ser AGA AAG Lya AGG Arg GCU GCC GUU GAU GAC GAA GAG GGU GGC Gly Asp GUC Val GUA Ala GCA GCG GGA Glu GGG GUG ACC T C A G. G. 6. G G A C T. T. G. Original DNA strand G T A G. G. T. G. G. GA CT T. G. Mutated DNA strand First letter Third letter
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What would the final protein product be? (only use the capitalized letters).
Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer. ACUGAAAUGACCAGAUUUAUGGCCUGAAUGACC
Sickle cell hemoglobin DNA CA CG TAGACTGAGGACA C Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence ValoHis.lku thro proo Gily 4. What type of mutation is this? Please explain why.
Describe missense and nonsense mutations and how they are different from frameshift mutations. Be comprehensive and tailor your answer to explain the impact of these mutations on the protein expressed
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
Туре of mutation: Effect: Original Altered protein/ amino acid sequence sequence DNA nucleotide MRNA AUUCGAGUA AUUCGGGUA amino acid MRNA ACGGAACCG ACGGUACCG amino acid MRNA GCUAGAAGU GCUUGAAGU amino acid MRNA GGCGCUACAUCA GGCAGCUACAUC A amino acid MRNA GGCGCUACAUCA GGGCUACAUCA amino acid
If a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid has very similar properties (e.g. non-polar amino acid substituted for another non-polar amino acid), then it is likely this mutation will have no effect on the function of the protein and will be termed a neutral mutation. O True False