Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine? 5'-GUGCAAUUU-3' 5'-UACCUAGCU-3' 5'-GGUCGCCAU-3' 5'-AUGGUAACA-3'
Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…
A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…
Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…
A: INTRODUCTION The DNA and it's corresponding mRNA is given below.
Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…
A: Complete this table of codes.
Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___. ATG-CGT UAC-GCA GUA-CGU AUG-CGU…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: Which amino acid sequence will be generated during translation from the following small mRNA:…
A: According to the hint given then the start codon is AUG (Met) The stop codon is UGA .
Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA…
A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA and…
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: An mRNA encodes a polypeptide that is 312 amino acids in length. The fifty-third codon in this…
A: The messenger ribonucleic acid (mRNA) is a molecule that synthesizes commands to produce products…
Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…
A: ANSWER;- N'-- C; 5'--3';
Q: For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons…
A:
Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…
A:
Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: if the codon for Leucine is 5'-CUG-3'. what is the sequence of the corresponding anticodon on the…
A: A transfer RNA (tRNA) is a type of RNA molecule whose primary function is to match an mRNA codon…
Q: In the DNA sequence,the bottom strand is a template strand.if the base pair
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…
A: Gene expression is the process by which the instruction in the DNA is converted to products through…
Q: When MRNAS are edited to become mature mRNA, the nonsense regions that are removed are called and…
A: Ribonucleic acid (RNA) is a significant organic macromolecule that is available in all natural…
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…
Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…
A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.
Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…
A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…
Q: Below is a diagram of charged TRNAS in the active site of the ribosome during translation of the…
A: Each aminoacyl-tRNA synthetase's active site functions as a "lock and key" for an associated tRNA…
Q: A sequence of DNA is as follows: 5'-A-T-T-G-C-C-G-3'. What mRNA sequence, in the 5' to 3' direction,…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: Given the following DNA sequence from the template strand of a given gene:…
A: Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…
Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…
Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…
A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…
Q: A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that…
A: If the template strand of DNA has AAA, it will be transcribed to mRNA as UUU. A tRNA that would…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…
A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…
Q: Which of the following precautions are NOT taken to stabilize mRNA? Polyadenylation at the 5'-end. O…
A: Eukaryotic transcription and translation occur at the different places. Transcription occurs at…
Q: What is the sequence of the MRNA codon that binds to the anticodon 3'-AAG-5'? 5'-AAG-3' 5'-TTC-3'…
A: Anticodon: A trinucleotide sequence that is complementary to a matching codon in a messenger RNA…
Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: What amino acid sequence will be generated, based on the following MRNA codon sequence? 5' AUG- UCU-…
A: The genetic code is the precise sequence of DNA nucleotides interpreted as three-letter words or…
Q: if the sequence of bases in the mRNA Codons is 5' - AUCCUACGU - 3' then the sequence of amino acids…
A: In the central dogma of molecular biology, DNA is converted into mRNA by the process of…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: The first nucleotide in mRNA that will be synthesized from DNA below is: 3'-…
A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…
A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…
Q: The number of amino acids produced by translating the mRNA (3'AUGCUUAGUCGCGUA5') is : a. 4 b. 5…
A: The three letter codes for amino acids are the universally accepted amino acid codes that are…
Q: Which statement is correct? OA cap is removed from the 5' end of a DNA molecule A сар A poly-A tail…
A: The biochemical substance that is carried from the preceding generations to the succeeding…
Q: Which of the following provide clues that a particular DNA sequence is part of protein-coding gene?…
A: A protein-coding gene is a DNA sequence that instructs the cell to create a specific protein.…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…
A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…
Q: DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met…
A: DNA => Transcription => mRNA => Translation => Protein Transcription: Formation of RNA…
Q: triplet of bases on an mRNA molecule is known as a(n)
A: A triplet of bases on an mRNA molecule is known as a(n) Answer: c) codon.
Q: A polypeptide is composed of 4 amino acids. How many nucleotide bases on an mRNA strand are…
A: The relation between the sequence of nucleotides of messenger ribonucleic acid (mRNA) and the amino…
Q: Which of the following would not be found in a mature mRNA in a eukaryotic cell? A Star Codon B…
A: Select the component that is not present in mature mRNA of eukaryotic cells. The given options areA.…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
- Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterThe following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine? Group of answer choices 5’-UACCUAGCU-3’ 5’-GUGCAAUUU-3’ 5’-AUGGUAACA-3’ 5’-GGUCGCCAU-3’For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- The following mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA UCC UCC ACU CCU UGA-3' Use the following codons and the amino acids they encode: AUG = Start or Met; UUU, UUC = Phe; UUA, UUG = Leu; UCU, UCC = Ser; CCU, CCC = Pro; ACU, ACC = Thr; UGA = Stop. Select one: O a. Phe-Leu-Ser-Ser-Thr-Pro O b. Met-Phe-Leu-Ser-Ser-Thr-Pro O c. Thr-Phe-Thr-Phe-Leu-Ser-Ser-Thr-Pro Od. Met-Phe-Leu-Ser-Ser O e. Thr-Phe-ThrConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).