Q: What amino acid is coded for by each codon? a. GCC b. AAU c. CUA d. AGC e. CAA f. AAA
A: GCC -Alanine AAU - Asparagine CUA - Leucine AGC- Serine CAA - Glutamine AAA - Lysine
Q: What amino acid is coded for by the mRNA codon 5'-GAG-3'
A: In this question, we have to describe GAG triplet codon code for which amino acid.
Q: Order of Order of Order of Amino Acid bases bases in MRNA | (codon) bases Coded into in DNA in TRNA…
A: As we know DNA contains A T G C Bases and RNA Contains A U G C Bases. mRNA is complementary to DNA…
Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…
A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…
Q: Since there are 61 sense codons (excluding stop codons), most cells contain 61 different types of…
A: A codon that codes for an amino acid is called the sense codon and there is three nonsense stop…
Q: The codons UGA, UAA, and UAG do not code for amino acids. What is their role as codons in mRNA?
A: Amino acids are the basic structural units or building blocks of proteins. Amino acids are used for…
Q: Isoleucine is encoded by three codons (5')AUU, (5')AUC, and (5')AUA. These three codons are…
A: Wobble hypothesis: This hypothesis was given by Francis Crick. According to this hypothesis the…
Q: A certain mRNA strand has the following nucleotide sequence: 5'—AUG—ACG—UAU—AAC—UUU—3' What is the…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: Which of these is a post-translational modification that targets a protein to the proteasome? LO…
A: Post-translational modifications include changes in the polypeptide chain after its synthesis during…
Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA…
A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA and…
Q: list the amino acid sequence that would be made in a ribosome using these codons: AUG CUA AGU…
A: A ribosome consists of two basic pieces of units containing a large and a small subunit. During the…
Q: There are no aminoacyl-tRNAs that will go to the A site of the ribosome when UGA is the codon. Is…
A: During termination of protein synthesis, protein synthesis ends when one of the three stop codons:-…
Q: CODON that corresponds with each amino acid
A: During translation where mRNA is being translated to proteins the sequence of nitrogen bases on the…
Q: The codon is found on mRNA? True or False?
A: Codon is a sequence of three consecutive nucleotides in DNA or RNA, that codes for a specific amino…
Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…
A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…
Q: A portion of an unknown enzyme has the amino acid sequence serine phenylalanine - glutamate -…
A: Gene is the sequence of nucleotides that encode a specific protein.
Q: The amino acids listed above that are coded by the mRNA codon
A: Protein synthesis is a major process inside our body .Our body has complex system for protein…
Q: The degeneracy of the codon system allows for silent mutations since often a mutation at the third…
A: Silent mutation is a mutation in which a change in the sequence of nucleotide bases with no change…
Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…
A: An open reading frame in molecular genetics describes the part of your reading frame that has the…
Q: Which amino acid is coded by the "stop" codons? O a. Pro
A: Codons are trinucleotide sequences. They can belong to RNA or DNA. They mainly correspond to the…
Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…
A: Genetic code is triplet of bases called codon. Genetic code is unambiguous (each triplet specifies…
Q: Which of the following codons is called the start codon?
A: AUG is the Start codon, which codes for Methionine.
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…
Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *
A: Amino acids production.
Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…
A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…
Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…
A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…
Q: Which of the following statements about protein elongation are correct? I. There is a nucleophilic…
A: Replication, transcription and translation are basic mechanisms performed by genetic material along…
Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…
A: The central dogma of life states that there is a unidirectional flow of information from master copy…
Q: A small section of mRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids…
A: mRNA is a ribonucleotide sequence produced as a result of transcription from DNA. Once the mRNA is…
Q: Which site bound by a tRNA most of the time? O A P O E
A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…
Q: According to wobble rules, what codons should be recognized by the following anticodons? What amino…
A: The tRNA is the transfer RNA that matches the mRNA codon with the set of three nucleotides,…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…
A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…
Q: Each tRNA has an _____ complementary to themRNA codon specifying the particular amino acid.?
A: Central Dogma of life is- DNA ---->mRNA -----> Protein The process of synthesis of a DNA…
Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…
A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…
Q: Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below.…
A: A) The resulting polypeptide from the mutated DNA sequence is- 5'-ATGTCCTGGTAA-3' Sense DNA…
Q: If a stretch of mature mRNA to be translated has 300 bases, the resulting peptide will have O 300…
A: Amino acids are chemical molecules that contain the functional groups amine (NH2) and carboxyl…
Q: Codons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first…
A: The sixty-four codons of genetic code comprise three nucleotides, determine the amino acids in a…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: What amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU…
A: Protein is synthesized via translation of mRNA template by ribosomes in the cytoplasm. mRNA has…
Q: The first MRNA codon to specify an amino acid is always Phe Leu (F) (L) Glu Asp (E) (D) Ser (S) Tyr…
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…
A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…
Q: Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence:…
A: So the given m-RNA code for - met-glu-ser-leu-leu.
Q: If MRNA has the bases UAU, what is the matching tRNA? O UAU O ATA O TUT O AUA
A: DNA(deoxyribonucleic acid) is the genetic material in all organisms except few viruses. The genetic…
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer.…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: The following pattern has been observed in the genetic code. For many codons, the first base…
A: The genetic code is a three-letter code employed by living cells to translate the information into…
Q: the complementary strand the 5'and 3' ends and identify corresponding codon as lled V, H, L, T, P,…
A: DNA is a double-stranded helical genetic material that contains hundreds of genes that code for…
Q: The mRNA codon of valine is GUC UGG CCA TTG
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Proteins
We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.
Protein Expression
The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineGiven the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence Met-Leu-Arg? (Be sure to include the stop codon.)
- What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter abbreviation with hyphens and no spaces in between.The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…Suppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.
- Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-LeRefer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonThe mRNA codon of valine is GUC UGG CCA TTG
- Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucineThe name for the kind of point mutation/base substitution when a codon changes from CCC (which codes for proline) to CGC (which codes for arginine) is mutation. 2nd base in codon U CAG Cys Cys STOP STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Phe U Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln C Asn Asn lle lle lle Met Thr Thr Thr Thr Ala Ala Ala Ala Lys Lys Asp Asp Glu Glu Val Val Val Val 3rd base in codon DCAGUCAGUCAGUCAG 1st base in codonThe chart can be used to determine the amino acid that a specific codon encodes. Finl Second Letter Thind Letter U с A G phenylalanine serine tyrosine cysteine U phenylalanine serine U tyrosine cysteine с leucine serine stop stop A leucine serine slop tryptophan G leucine proline histidine arginine U leucine proline histidine arginine с leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine C isol cine threonine arginine A (start) lysine lysine threonine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine C valine alanine glutamate olycine A valine alanine glutamate glycine G If a strand of DNA had the sequence GACTTC, then mutated to be GACATC, what sequence of amino acids would be formed? Aspartate and phenyalanine become apartate and isoleucine Leucine and lysine become leucine and tyrosine Aspartate and phenyalanine become aspartate and methionine Leucine…