Which of the following is a property or characteristic of eukaryotic promoters? O They contain the -10 and -35 consensus sequences where RNA polymerase holoenzyme, containing the sigma factor, bind to initiate transcription. O They contain the -10 and -35 consensus sequences that are the site where general transcription factors bind to help RNA polymerase holoenzyme initiate transcription. eu They contain a TATA box to which sigma factors bind to help RNA polymerase core enzyme initiate transcription. Oy They are usually located far away from the gene that is being transcribed. y They are bound by general transcription factors, which help RNA polymerase L II, or III, bind to the promoter and initiate transcription.

Which of the following is a property or characteristic of eukaryotic promoters? O They contain the -10 and -35 consensus sequences where RNA polymerase holoenzyme, containing the sigma factor, bind to initiate transcription. O They contain the -10 and -35 consensus sequences that are the site where general transcription factors bind to help RNA polymerase holoenzyme initiate transcription. eu They contain a TATA box to which sigma factors bind to help RNA polymerase core enzyme initiate transcription. Oy They are usually located far away from the gene that is being transcribed. y They are bound by general transcription factors, which help RNA polymerase L II, or III, bind to the promoter and initiate transcription.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

In 3-4 sentences eachExplain the difference between prokaryotic and eukaryotic transcription. Explain the difference between an activator and a repressor? Explain the difference between a promoter and an enhancer? Explain the difference between an intron and an exon? Explain what happens when eIF-2 is phosphorylated and when it is not phosphorylated?
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
A TATA box is a short, A-T rich sequence of nucleotides located just upstream of genes and is used to recruit transcription factors and RNA polymerase to begin transcription. Based on this description, a TATA box is most likely a(n): promoter terminator transcription factor RNA polymerase
Which of the following statements is/are TRUE for the promoters? The Pribnow box and TATA box are found in the prokaryotes and eukaryotes, respectively. For both prokaryotes and eukaryotes, the first ribonucleotide attaches to the TSS region. The -35 element in prokaryotes is called the Up element in eukaryotes. In prokaryotes, the Pribnow box is located 25 bases before TSS.
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT O The mutation would bind the promoter to the consensus and produce normal levels of transcription O The mutation would inhibit the promoter thereby inhibiting transcription The mutation would move the promoter away from consensus and reduce the level of transcription O No change the consensus TATAAT sequence in the same. D00 F3 F4 F5 F6 F7 F8 F9 % & 5 6 7 8 9 %24
A particular mutation in the bacterial sigma factor allows this protein to bind RNA polymerase but prevents it from coming off (detaching) RNA polymerase once it binds. What specific effect will this mutation have on transcription? It will prevent the transcription termination exerted by the Rho protein. It will prevent the formation of closed complexes between RNA polymerase and the promoter. It will prevent the formation of open complexes between RNA polymerase and the promoter. It will prevent the transition from the transcription initiation to the transcription elongation stage. It will prevent the synthesis of abortive RNA transcripts while the RNA polymerase is bound at the promoter.
Why might repression of a eukaryotic gene by an RNA be more efficient than repression by a protein repressor? O Protein repressors only prevent the synthesis of a single splice variant of a gene. O RNA repressors bind directly to nucleotide sequences in genes, preventing their transcription. O Protein repressors are inherently unstable, so they degrade quickly and do not completely repress genes. O Synthesis of RNA repressors is less energetically costly than that of protein repressors.
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcription
Consider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
Which of the following is/are true regarding transcription initiation in bacteria? TFIID will bind the promoter at the -10 and -35 consensus sequences, then it recruits RNA polymerase Il to initiate transcription. RNA polymerase core enzyme binds the promoter at the -10 and -35 consensus sequences, then initiates transcription with the help of the sigma subunit. TFIID binds the promoter at the TATA box, then recruits RNA pol Il to initiate transcription. The sigma subunit protein of the RNA polymerase holoenzyme binds the promöter at the -10 and -35 consensus sequences, then the holoenzyme unwinds the DNA and initiates RNA Svethocie Bacteria are only able to initiate transcription of genes when ribosomes are available. Ov.
Which of the following sites would you predict to be present in the gene encoding a MRNA molecule and what would be their order? LIST OF SITES #1 Promoter #2 Ribosome Binding Site #3 Translation Initiation Site #4 Translation Termination Site #5 Transcription Initiation Site #6 Transcription Termination Site O 3, 1, 2, 6, 4, 5 O 1, 3, 2, 5, 6, 4 О 1,5, 2, 3,4, 6 О 1,3, 2,4 О 1,3,4