Which of the following functions can be fulfill Form sticky ends to insert genes Create mutations in target DNA Cut RNA Cut sequences at an alternative site Guide CRISPR to the target DNA Cut target DNA
Q: What is Scientific revolution? Why do we students have to learn about this?
A: Answer : Early modern science was reproduced during the scientific revolution, when discoveries in…
Q: . Which capillaries are fenestrated? a. glomerular capillaries b. peritubular capillaries c.…
A: Your kidneys hold a distinctive place in the importance of fenestrated capillaries. They are present…
Q: Using a complete sentence, describe one ecosystem service plants provide?
A: Introduction Multicellular, eukaryotic living things with multiple cells make up the category known…
Q: What are the 3 types of post-transcriptional modifications and what are they for?
A: Transcriptional modification is a set of biological processes in which an RNA transcript is…
Q: Does golgi apparatus form plasma membrane and lysosomes?? How?
A: Golgi apparatus is a membrane-bound organelle that is present in the eukaryotic cells. Its primary…
Q: the major component of the proton-motive force is the: differential concentration of protons across…
A: An electrochemical proton gradient, or protonmotive force (pmf), is produced during mitochondrial…
Q: !!! Adenine Cytosine Thymine Guanine Total 42.5 100
A: Due to their capacity to form hydrogen bonds between the corresponding bases, the adenine (A) base…
Q: As electrons move through the electron transport chain of photosystem II, they lose en- ergy. What…
A: In photosystem II, the reaction centre chlorophyll a absorbs 680 nm wavelength of red light, that…
Q: 1. True or False: 1. WBC's, like monocytes can live for years 2. Changes in elevation affects…
A: 1. First of all, monocyte itself is a WBC. Also life span of WBC's is around 13 to 20 days and not…
Q: In a population of 300 humans, the following blood type frequencies for the MN blood group are…
A: Blood group of an individual is determined by presence/absence of antigen on RBC 's surface and…
Q: The biomolecular interaction between protein receptors and ligands is similar to that of en- zymes…
A: the function. of cell is controlled by its Receptors . the action of cell may be increase Or…
Q: a- Species who are in the same clade are considered to have divergent evolution. b-An example of…
A: The term "theory of evolution by natural selection" was first coined by Charles Darwin and Alfred…
Q: Pollen contains the complete genetic material of the plant and is airborne. Describe ways in which…
A: Issues regarding the environmental effect of genetically modified crops are now limiting their…
Q: A new screening program was instituted in a certain country. The program used a screening test that…
A: The incidence rate is the proportion of total cases to total population exposure to disease. The…
Q: True or False compared with NAD+, electrons transferred to FAD lead to less proton translocation in…
A: NAD+ and FAD are cofactors that play an important role in cellular respiration. They are involved in…
Q: C-In humans, the Rh factor genetic information is inherited from our parents, but it is inherited…
A: p2+2pq+q2=0 p2 = dominant homozygous frequency (AA) 2pq = heterozygous frequency (Aa) q2 =…
Q: The workout is done, and it’s Fatima’s second favorite part of the practice – time for chocolate…
A: 1. Insulin level will increase as the function of insulin is to convert glucose to glycogen. As…
Q: (d) Suggest one method to treat Helicobacter pylori infection.
A: A gram-negative, microaerophilic spiral bacterium called Helicobacter pylori, formerly referred as…
Q: Give an example that shows the relationship between cause, outcome and confounders in the field of…
A: Relationship between Cause, Outcome and Confounders are seem to demonstrate mixing of effects with…
Q: Question 2 Which of the following events takes place during the M phase of the cell cycle? ODNA…
A: Introduction : Cell cycle is divided into 2 phases. Interphase and M-phase. Interphase is the…
Q: conveys the most accurate information. i. Information in the histogram in panel (a) may be used to…
A: From given data it is estimated that heritability of traits ,the increment in the tail of rat is…
Q: Report the differences you've observed between the nucleotide sequences of the different species in…
A: The process by which species adapt to their environment over time is called evolution. The…
Q: 4. Purple Flowers In another one of Mendel's experiments, he crossed the offspring. Two pea plants…
A: Sir Gregor Mendel is considered as the "Father of Genetics" for his work on the principles of…
Q: The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…
A: DNA is a double helical structure with two DNA strands. One strand serves as a template for the…
Q: parents Imagine two heterozygous for cystic fibrosis come to ask you about the probability of their…
A: Introduction:- A Pedigree is a family tree, consisting of symbols and lines that shows the pattern…
Q: Ras/MAP kinase signal transduction cascade
A: MAPK signaling pathway: It is also known as the Ras-Raf-MEK-ERK pathway. It is a chain of proteins…
Q: A farmer decides to plant Xmas trees. She estimates each one will sell for $75. -How much will the…
A: Given that the farmer wants to plant Xmas trees on 10 acres of land. If she can grow 50 Xmas trees…
Q: Discuss the human impacts on aquatic ecosystems
A: Numerous human activities have an adverse effect on the natural environment, including overcrowding,…
Q: Use your knowledge of population growth models to evaluate the spread of Covid-19 in the world…
A: Depending on particular environmental factors, two different patterns of population expansion may…
Q: The difference between PCR and real-time PCR is that real-time PCR: can determine the DNA sequence,…
A: The correct answer is option C. can measure the amount of DNA amplified as the reaction proceeds,…
Q: Problem 4: In Andalusian fowls, the heterozygous condition for the alleles of black plumage and…
A: In the given case, let the allele associated with recessive condition be “b” and allele associated…
Q: Based on the following graph, the number of base pairs of a fragment of DNA that has migrated 39 mm…
A: A separation technique known as electrophoresis relies on the movement of charged species in a…
Q: In horses, black coats and trotting gait are dominant while the recessive alleles are white and…
A: As the back coats and trotting gait are dominant, let us take them as B and T. 1. Since the male is…
Q: Location Bahia Blanca, Argentina Tehran, Iran Seoul, South Korea Darwin, Australia Nuuk, Greenland…
A: Introduction:- A biome is defined as an distinct ecological community comprising of both flora and…
Q: How does the rabies virus spread through the human body after a bite?
A: Introduction : Viral rabies is a deadly illness. The rabies virus can be carried by animals such as…
Q: The bacterium Agrobacterium infects plants and causes plant cells to develop tumorlike cellular…
A: In the wild, the A. tumefaciens wild type causes "crown gall disease," which is characterized by the…
Q: Prothoracic glands hormones Insects 5 True - False Secrete juvenile which stimulates moulting in
A: According to the question, answer is False. Because prothoracic glands do not secretes the juvenile…
Q: In nickel column affinity chromatography，how does the protein binds to column？How is the protein…
A: Column chromatography is a very common method of protein purification.Proteins may vary hugely in…
Q: Given an observed F2 data set, a specified gene, and two phenotype classes (disease and wild type),…
A: Chi-Square Test is a biostatistical process which helps to determine the difference between expected…
Q: 1. Match the term with the correct definition. Portion of DNA which codes for a protein, which leads…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Phenotypes for quantitative traits are determined by multiple alleles at multiple loci. ii.…
A: (B) Statement v conveys inaccurate information Because, in quantitative trait locus the region of…
Q: The carotid artery of an animal is partially constructed proximal to the carotid sinus during a…
A: Introduction:- The carotid arteries are a component of systemic circulation that transport blood to…
Q: Most genes coding for proteins would fall into which class of DNA? A. highly repetitive DNA B.…
A: Introduction Proteins are made of structural building blocks called as amino acids and are found in…
Q: 7. In a monohybrid test-cross with simple dominance, the F2 generation is expected to: a. express…
A: Monohybrid cross It refers to a cross between two homozygous individuals, which produces the…
Q: Explain why the evolution of the four-chambered heart was critical for the development of an…
A: In animals having exothermic lifestyle (cold blooded animals), energy requirements are less compared…
Q: What are Phytochrome, photoreceptor, red and far-red light?
A: The research of plants, particularly their construction, characteristics, and metabolic activities,…
Q: 1. A 43-year-old male presented to the emergency department (ER) with complaints of fatigue, night…
A: (A) As lung lesions are found in the patient, sputum is the most important sample for this patient's…
Q: peptide hormones and growth factors act on target cells by binding to receptors located at the:…
A: Introduction Just like different cellular peptides, peptide hormones are encoded in genes, that is…
Q: After fertilization, the pollen grain... ovule gametangia... ovule ovule.... ovary ovary... ovule…
A: Introduction A process known as pollination is used to fertilise flowering plants. When pollen from…
Step by step
Solved in 2 steps
- Which of the following is a correct statement about CRISPR-Cas-9 gene editing? Group of answer choices A single guide RNA (sgRNA) recognizes a genomic region followed by 5'-NGG-3' PAM sequence A single guide RNA (sgRNA) recognizes a genomic region followed by a long sequence palindrome repeat A single guide DNA (sgDNA) recognizes a genomic region followed by 5'-NGG-3' PAM sequence PAM sequences induce single stranded breaks that are then repaired by the CAS-9 enzymeWhat is the role of the following molecules in the CRISPR mechanism? * Sequence of 3 nucleotide Not a RNA significant sequence Endonuclease motif that is Host genetic synthesized role in information to match a a binding CRISPR target site mechanism sequence Cas9 guide RNA DNA polymerase PAM Cellular DNA TRNA O O 口 ロ 口 ロロConsider the reagents required to perform CRISPR genome editing. Which molecule specifies the a new sequence that will occur at the target site if genome editing is successful? Cas9 nuclease Cas1 Cas2 tracrRNA crRNA sgRNA donor DNA
- Which of the following types of mutations would be produced by repair of a CRISPR-targeted double stranded break through non-homologous end joining? acquisition of a point mutation specified on a donor DNA template deletion duplication inversionCRISPR/Cas9 can be used in genome editing. Among the following statements, which one is correct? The CRISPR and the Cas9 parts both recognise the DNA target sequence and then recruit an endonuclease for cutting it The Cas9 part recognises the DNA target sequence and the CRISPR part cuts it The CRISPR and the Cas9 parts both recognise and cut the DNA target sequence. The CRISPR part recognises the DNA target sequence and Cas9 cuts it.The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
- Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’Describe one way in which DNA double stranded break repair that occurs because of X-ray damage differs from that caused by Crispr/Cas9 and one way in which they are similar.Which of the following statements is not true about the guide RNA (see this interactive demonstration for help with this question: https://www.biointeractive.org/classroom-resources/crispr-cas9-mechanism-applications) Group of answer choices it contains a sequence of 20 nucleotides that matches a specific sequence in a cell’s DNA When the guide RNA is combined with Cas9, it will guide Cas9 to the target sequence its target sequence can be almost any sequence as long as it occurs near a PAM motif it is a nuclease, a type of enzyme that cleaves DNA
- Label the following parts of the CRISPR-Cas 9 system. C A B C D Target DNA strand PAM sequence Cas9 protein Single-guide RNAPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAWith regard to RNA polymerase proofreading ability, which of the following is true? A 3'5' exonuclease fixes all errors in mRNA. There are specialized mRNA repair pathways that remove noncomplementary nuclec No proofreading occurs. RNA backtracking can remove noncomplementary nucleotides. RNA and DNA polymerase proofreading are essentially identical. OOOOO
