Which of the following are the inputs of the light reactions? Choose all that apply. carbon dioxide gas NADP+ ADP+P oxygen gas ATP water O NADPH sunlight

Q: How is UV exposure an example of phenotypic plasticity

A: The ability of a genotype to express different phenotypes depending on its environment is referred t...

Q: Question # 138 A 53-year-old man comes to the office because of difficulty reading fine print over t...

A: B. Lens elasticity is most likely abnormal in this patient. The lens of the eyes needed to see objec...

Q: How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside tr...

A: The nucleic acids are made up of pentose sugar, nitrogenous base and phosphate molecule. The group o...

Q: Describe an electrochemical sensor assay method for rapid bacterial detection and identification. Wh...

A: Electrochemical sensors work on the principle of sensing, recognition and production of electrical s...

Q: What insects are expected to have the most sclerotized heads? Explain. Does an exoskeleton have an i...

A: The epicuticle, a thin protein coating on the outside, and the procuticle, a thick chitin–protein la...

Q: You are a genetic counselor, and you received the following pedigree to analyze. You must determine ...

A: In this following pedigree shows total 3 generation, 13 family members where 10 members are affected...

Q: How Small Noncoding RNAs Play Regulatory Roles in Bacteria ?

A: Small RNAs (sRNAs) influence gene expression via base pairing with mRNA after transcription. The int...

Q: sars-coV-2 spike protien what is the isoelectric point of this peptide? VGIYLQKTSDHRPEFALAMN

A: ANSWER;- In order to the logical examination on the extreme intense respiratory disorder Covid 2 (SA...

Q: Select all the statements that provide evidence that DNA is the genetic material. Check All That App...

A: The eukaryote chromosome is linear and contains both DNA and protein, and both are found in equal ma...

Q: You calculate an interference value of 0.59. What does this number tell you? a. You will not observe...

A: Answer: (C) you will observe 41% of double crossover.

Q: Nde I EcoR I Sal I KpnI BamH I PUST MCS ori Xho I Amp BamH I Kpn I EcoR I BamH gene W pn BamH I Xho ...

A: Gene insertion is that the addition of one or a lot of genes into a desoxyribonucleic acid sequence,...

Q: Myoglobin is a carbohydrate which in normally found in muscle tissue. True False Chromatin is compos...

A: It specifies a single polypeptide chain with one oxygen binding site. Myoglobin has a heme prostheti...

Q: Energy is released reactants This graph shows an reaction. AG < 0 products Time Gibbs Free Energy

A: The chemical reactions involve the exchange of energy. The reaction can either absorb or release ene...

Q: Trace the flow of hemolymph circulation in the insect circulatory system. Be able to explain how nor...

A: Insects, like all other arthropods, have an open circulatory system that differs from the closed cir...

Q: NERVOUS SYSTEM PATIENT TERMS ASSIGNMENT Identify the medical term for the following patient describe...

A: Nervous system disorder: Structural disorders in neurons present in brain , such as brain or spinal ...

Q: What are the factors which need to be considered in the selection of culture vessel?

A: Culture vessels:- Culture vessels provide a contamination barrier to protect the cultures from the e...

Q: 1b. If the undertermination thesis is false, then scientific theories can be deduced from observatio...

A: Undetermination thesis It is a thesis that states that for each scientifically established hypothesi...

Q: w humans caused the lion fish inva

A:

Q: One of the biggest drawbacks of cell culture is the amount of time and materials required to produce...

A: Answer :- By and large, the most widely recognized issues incorporate strange development designs or...

Q: What is the most likely order of the linked genes R, S, and T if the distance between R and S is 22 ...

A: The above scenario based on linkage and maping.

Q: . identify the overall functions and significance of these systems in maintaining homeostasis 3. des...

A: Homeostasis is the state of equilibrium inside a system that allows it to function under a range of ...

Q: Complete the sentences relating to organogenesis, matching the first part of the sentence on the lef...

A: Ans) 1.Formation of heart tubes involves -B.mesenchyme to epithelial transition 2.Formation of the n...

Q: Describe phosphorylation and give an example

A: Phosphorylation is classified as a biochemical process. This biochemical process comprises attachmen...

Q: What are the functions of the cardiovascular system?

A: The cardiovascular system consists of the heart, blood vessels, and blood. Its primary function is t...

Q: How many strutures are found in an animal call

A: Animal cells can range in size from a few millimetres to a few centimetres. The ostrich egg is the l...

Q: Explain what is meant by the term homologous chromosomes ?

A: Chromosomes are condensed forms of chromatin that are visible during cell division. They were found ...

Q: An Hfr strain of E. coli that is pro thr * leu * lac " was "mated" with an F- strain that is pro thr...

A: Introduction Genetic recombination is a process of exchange of genetic material between two differen...

Q: Name the algae that shown in pic.

A: There are several filamentous algae and the examples include Spirogyra, Nodularia, Anabaena, Oscilla...

Q: 1. identify and describe the basic structures forming the digestive, respiratory and circulatory sys...

A: Homeostasis is the state of equilibrium inside a system that allows it to function under a range of ...

Q: Explain the mechanism by which cells sample extracellular fluid.

A: Extracellular fluid refers to bodily fluid that is not contained within cells. It can be present in ...

Q: the effects of a single allele (A2) on fitness in two populations of the same plant species, Populat...

A: The average excess of fitness is a measure of the fitness of a particular allele (Say aA2). It can b...

Q: If the cloning was successful and the plasmid contained the elements needed for blue-white screening...

A: The screening of transformants after the cloning is a critical step as it allows the identification ...

Q: For the following Chi-square table, how many degrees of freedom should be used when calculating the ...

A: Introduction:  The chi-square degrees of freedom are determined using the formula df = (r-1)(c-1), w...

Q: What role does understanding the origins of the insect alimentary canal have in comprehending each d...

A:   INTRODUCTION        In insects, their digestive system make their nutrients and other sources of s...

Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...

A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...

Q: How are these examples of phenotypic plasticity? 1. Haman weight 2. UV exposure 3. Flower color/pH

A: Answer :-  1. Human weight :-  Phenotype is the noticeable physical or biochemical qualities of a in...

Q: Describe natural selection and give natural selection at work in a population an example of

A: The process through which the well-known stated that the term which is the populations of living cre...

Q: What types of gametes are formed by the following genotypes? All gene pairs are segregating independ...

A: The number of gametes formed is determined by the number of heterozygous alleles present within the ...

Q: What is the value of the 2-hour postprandial blood sugar level above which the dose of an oral antid...

A: A post prandial blood sugar of more than 200 mg/dL is considered DIAGNOSTIC of Diabetes Mellitus and...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: In cyclic photophosphorylation, an electron in P700 is excited by a photon and begins to taking the ...

A: The light reaction of photosynthesis involves production of ATP and NADPH by using sunlight. In this...

Q: Explain the relationship between turgor and osmotic pressure

A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...

Q: Which type of molecule recognizes macromolecules that are present in/on certain groups of pathogens?...

A: Introduction: Phagocytosis is a process in which the phagocytic cells engulf the microbes. It is an ...

Q: What is adaptive immunity ?

A: Immunity is a complicated biological system with the ability to recognise and tolerate what belongs ...

Q: Flg. 1. Breast cancer families 1 to 7. Solid circles, females with breast cancer; open circles, fe- ...

A: Solution:- We are given the following probabilities:P(woman will develop breast cancer gene) = 1/10P...

Q: DNA replication

A: Introduction:- DNA, also known as deoxyribonucleic acid, is a nucleic acid molecule. A 5-carbon deox...

Q: 4. (1) How many females and males are affected in this pedigree? (2) Who is the proband? II (3) How ...

A: NOTE-"As per our honor code, we are authorized to answer only one question at a moment. As you have ...

Q: You crossed tall pea plants to another tall pea plants. You collected all the seeds and planted them...

A: Mendel selected pea plants to investigate genetics because they had clearly recognizable characteris...

Q: Describe the smaller and largest living unit of nerve cells

A: "The nervous system" of all animals is made up of unique cells known as neurons, which serve as the ...

Q: F G А C

A: INTRODUCTION The names of the parts of the flower is given below.