Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs? EF-Ts EF-Tu EF-p EF-G
Q: Please fully explain (use illustrate where appropriate) the Modes of Enzyme Catalysis exemplified by…
A: Chymotrypsin is a protease enzyme that cleaves the proteins at the C-terminal end of phenylalanine,…
Q: 2. Assume you have identified a new operon in bacteria (which you call the suc operon) that encodes…
A: Gene expression in prokaryotes is under the control of an operon system in which the transcription…
Q: Illustrate and compare the primary and secondary structural levels of nucleic acids.
A: Nucleic acids are polymers consisting of nucleotide-named monomers. A nucleotide consists of a…
Q: Which lipoprotein removes lipid plaques from blood vessels? A.VLDL B.HDL C.LDL D.chylomicron
A:
Q: What hormone triggers fatty acid biosynthesis? a.dopamino b.insulin c.vasopressin d.epinephrine
A: Fatty acid biosynthesis is the process of creation of fatty acids from acetyl-CoA and NADPH by the…
Q: Lipid A Protein If you ate a spoonful of peanut butter for breakfast, the majority of the energy…
A: There are various biomolecules which are energy source for body like carobohydrates, sucrose,lipids…
Q: Which of the following corresponds to the three basic components of a mononucleotide? O Phosphate…
A: The Nucleotides are building blocks, of DNA and RNA and DNA and RNA molecules are polymers made of…
Q: According to the figure below, which of these proteins might be expected to reside in the…
A: The mitochondrial membrane: Made of phospholipid bilayer; has porin to allow passage of small…
Q: In an alpha helix, U the peptide chain is fully extended there are hydrogen bonds parallel to the…
A: Amino acids are the building blocks of proteins . They are joined by Peptide bond to form a linear…
Q: Identify which amino acid pairs below will not form R-group interactions necessary for the tertiary…
A: Amino acids are building blocks of proteins, alpha carbon of amino acid contains, carboxyl, amino,…
Q: Explain the presence of the protein identified by peptide keratin, type I cytoskeletal ?
A: Intermediate filaments are cytoskeletons composed of various proteins such as keratins, desmins,…
Q: Q4. The estimated pKa of hydroimidazolone's R group is 6.93. If the pK₁ (α-COOH) and pK₂ (α-NH3) of…
A: Amino acids are biomolecules in which an amino group and a carboxyl group are linked to the same…
Q: In terms of functions of proteins in cells; how does enzymes function as catalysts
A: There are two conditions that must be met for life to exist: Organism must be able to replicate…
Q: Residue Asn 204 in the glucose binding site of hexokinase IV was mutated, in two separate…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Question 4: Tropomyosin is a 93 kDa protein which sediments at 2.6S (the sedimentation coefficient S…
A: Hemoglobin - is a oxygen and carbon dioxide transport protein kin red blood cells. It is a spherical…
Q: In isolating eukaryotic DNA, it is essential that the DNA is not sheared, and that high molecular…
A: DNA extraction refers to separating DNA from protein, membrane, and other biological components in…
Q: The oxidation of glucose takes place in two stages: glycolysis and aerobic respiration. Where in the…
A: Oxidation of glucose refers to the process of producing energy, ie ATP, from glucose. Two metabolic…
Q: What protein is activated in the cytoplasm due to activation of the insulin receptor? protein…
A: Insulin signaling is active when blood glucose concentration is high. Insulin signaling cascade…
Q: Chemistry 1. Explain why gluconeogenesis is NOT just a reversal of glycolysis.
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: 4 A lab technician has 90 ml of crude extract from a mouse heart. They want to determine how many…
A:
Q: The above reaction coordinate diagram in the presence of enzyme is inconsistent with the "lock and…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: QUESTION 17 calculate the KM AND the total amount of enzyme present in these experiments. The…
A: As given in the question, Kcat (turnover number) = 5000 min-1 KM = ? Et (total enzyme concentration)…
Q: why the human dna is considered as a fibonacci sequence?
A: A Fibonacci Sequence is where each number is the sum of two preceding numbers, like…
Q: What is reaction time, why do we measure it? How is it calculated?
A: Chemical kinetics is a branch of chemistry which deals with reaction rates and extent to which a…
Q: Chymotrypsin is a digestive enzyme with a catalytic optimum between pH 7.8 and 8.0. However, due to…
A: Henderson-Hasselbalch equation relates pH, pKa and the ratio of concentrations of protonated to…
Q: 1. Draw a standard curve of absorbance at 420nm against glucose concentration in mmoles/L. We…
A: Glucose concentration of an unknown sample can be calculated by using a standard curve, which is…
Q: 3. The electronic photograph shows an organelle, which is a large polyprotease complex- consisting…
A: The eukaryotic cell is compartmentalized into various subcellular compartments that perform…
Q: Which of the following statements is true for double-stranded DNA? O All of the given choices are…
A: All cellular lifeforms have DNA as their genetic material. A double stranded DNA (dsDNA) is composed…
Q: he Calvin cycle can be divided into which two stages? a.Preparation, fixation, reshuffling,…
A: Calvin cycle or C3 cycle can be divided into three main stages: 1. Carbon fixation 2. Reduction 3.…
Q: Table 1: Absorbance data @ 500nm for Glucose standards (0-20mM) and tests solutions Tube Number…
A: Standard curve for glucose concentration is constructed by taking concentration of glucose on x axis…
Q: Briefly describe the insulin signalling pathway. Explain what insulin resistance is and how it is…
A: After a meal, there is a surplus supply of glucose in the blood. this causes the pancreas to secrete…
Q: Posttranslational modifications of proteins do not include: peptide bond formation glycosylation…
A: Proteins are one of the essential biomolecules for life. These are formed by translation from the…
Q: 1. Why are eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) important?
A: Since you have asked multiple questions we will solve the first question for you. If you want any…
Q: The first enzyme in the Krebs cycle is the A.citrate synthase B.pyruvate dehydrogenase C. α-…
A: Kreb's cycle is also called as citric acid cycle or TCA (Tricarboxylic acid cycle). It is a common…
Q: Write a balanced chemical equation for the fermentation of one glucose molecule in starch to…
A: Starch is a homopolymer of glucose attached through alpha(1-4) and alpha(1-6) glycosidic linkages.…
Q: Why is the enzyme added last? Why can’t it be added at the start and the rates measured sometime…
A: For an enzyme catalysed reaction, the graph of the initial rate of reaction vs substrate…
Q: Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio…
A: RNA is single-stranded and it contains the C and G in the ratio of 3:1 ratio. RNA is composed of…
Q: Which of the following correctly describes the reactions in the β-oxidation cycle? oxidation →…
A: Beta oxidation is a process in which fatty acids are broken down to produce energy from them .
Q: What is the precursor of Cholesterol? a.Acetyl-CoA b.Glycerol c.Isoprene d.Fatty acid
A: Cholesterol is produced by the liver as well as by the majority of cells in the body. Lipoproteins,…
Q: Which of the following is/are NOT (an) essential fatty acids? A. arachidonic acid B. linoleic acid…
A: Essential fatty acids can be defined as those fatty acids which body cannot synthesis but are…
Q: Structures of L-Cysteine from highly protonated to depronated form. Note Structure A as the most…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: O HO NH₂ ZI Z-/
A: Aminoacids are the building blocks of proteins that consists of Amino group and carboxyl group as…
Q: The weight ratio of body fat stores to body glycogen stores is approximately O 1:10 O 10:1 30:1…
A: Glycogen is a carbohydrate polymer that is primarily stored in the liver and skeletal muscles. Fat…
Q: Which of the following pairs are both structural polysaccharides? cellulose and chitin amylose and…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which of the following statements about trans-fatty acids is/are FALSE? a.Healthier than…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Which of the following is CORRECT about the movement of e- in photosynthesis? A. H20 → Pheo → PQ →…
A: Photosynthesis is the process by which plants utilise sunlight to generate energy required for their…
Q: Which of the following statements is/are TRUE for both replication and transcription? Polymerase…
A: DNA replication is the biological process of producing two identical copies of DNA from a double…
Q: How many ATP molecules would be generated if an 8-carbon fatty acid were metabolized solely by the…
A: The citric acid cycle (also known as the Krebs Cycle) is a portion of the much larger process known…
Q: essay on how important to have adequate knowledge of biochemistry in understanding pharmacology
A: Biochemistry is the Study of life processes or biological processes by applying the knowledge of…
Q: Without checking the accuracy of a given Pipetman, would you pre- dict that it is better to use a…
A: Micropipette are the tools used for measuring, transfering a very fine volume in the range of…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?
- EF-Ts
- EF-Tu
- EF-p
- EF-G
Step by step
Solved in 2 steps
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-GlA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Pro
- Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino AcidHere is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- The amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences of the mRNA and the transcribed DNA strand that code for it? What are the anticodons?Identify the mRNA codons that could have been used in the protein synthesis process to convert DNA to Gly-Ser-Leu-Tyr-Asn-Ser-His-Glu-Pro-Pro-Ala-Arg-Asp. Don't forget to start and stop codons. Want solution ASAPUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU