When large genomes are sequenced, which of the following is true? Group of answer choices The genomes are converted from RNA to cDNA using reverse transcriptase, and then the cDNA is sequenced. The genomes are fragmented, the DNA fragments are sequenced by any number of methods, and the sequences assembled to provide the original complete genome. Sanger dideoxy sequencing is never used – instead, only nanopore sequencing is used. The assembled sequences must have all gaps closed if the genome is to be useful for the research community.

When large genomes are sequenced, which of the following is true? Group of answer choices The genomes are converted from RNA to cDNA using reverse transcriptase, and then the cDNA is sequenced. The genomes are fragmented, the DNA fragments are sequenced by any number of methods, and the sequences assembled to provide the original complete genome. Sanger dideoxy sequencing is never used – instead, only nanopore sequencing is used. The assembled sequences must have all gaps closed if the genome is to be useful for the research community.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 9QP

See similar textbooks

Similar questions

Question:- When completing genome sequences, contiguous sequences, or contigs are important intermediates. Which of the following is true about contigs? Group of answer choices The smaller the contig, the better it is for a complete genome assembly. A contig represents the sequence production from a single sequencing reaction. A contig is the name for a fragment of DNA made from a larger genomic DNA or chromosome, prior to its sequencing. A contig represents a DNA sequence assembled from smaller sequencing reads, and has no gaps.
Question:- Is DNA sequencing a in vivo, in vitro and/or in silico? What product(s) is/are formed in DNA sequencing and how and where would the reaction begin? Also, what raw materials are needed?
QUESTION: Transcribe the gene. Write out the correct sequence of m RNA bases. Notice that this is the same gene as in B above. Recall that in RNA, thymine (T) does not exist and uracil (U) takes its place. 3' ССА TAG CÁC CTT GTC ACA ACG TGT TCG TAG ACA 1 3. 4. 6. 7. 8. 9- 10 11 AGG AAC АТА ATA GTT AAC CTT TTG ATA ACA ТТА ACT 12 13 14 15 16 17 18 19 20 | 21 in
Question:- If you have 7 large DNA duplexes, how many TOTAL DNA duplexes will you have after 7 rounds of PCR (include large-medium, medium-short, and short-short)? If you have 7 large DNA duplexes, how many short-short DNA duplexes will you have after 7 rounds of PCR (do NOT include large-medium and medium-short)?
QUESTION:- Whole genome sequencing provides the most comprehensive genomic information. Nevertheless, there are many instances when microarrays or limited sequencing of a selected panel of genes are the approaches chosen for clinical use , Why?
question- If you wanted to make a cDNA library , which of the following enzymes would you definitely NOT need? SELECT ALL THAT APPLY. RNA polymerase, Cas9, Restriction enzymes, DNA ligase, Reverse transcriptase, Phosphatase
Question:- Many cancer treatment drugs specifically target DNA synthesis/replication. Find a drug that is currently used in cancer treatment Tell me what it is used for (e.g. any specific types of cancers?) What specific DNA process does it target? From a molecular biology perspective (what you have learned so far), what are the negative outcomes of targeting this process?.
Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG
There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer Bank
Give only typing answer with explanation and conclusion Recombinant human insulin produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mRNA only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns 1. Every cell in the human body has the same DNA, so very cell has an insulin gene. However in order to use the technique, you described in b, you would have to start with cells from the pancreas the only body cells that actually produce the insulin protein. Why are these the only cells that would work.
Question:- Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.
5) Answers to the following questions. A. You are given a tube containing 275 ng of purified PCR product (DNA) that is 1262 bp long. How many picomoles of PCR product are in the tube? The average weight of a deoxynucleotide monophosphate is 328 g/mol. B. You digest a 5 kb plasmid with two enzymes that yield fragments of 4 kb and 1 kb, and resolve the digest on the gel. What would you predict to see in terms of the intensities of the bands?