Q: Drag the text blocks below into their correct order. Immediately after double fertilization, the…
A: A eudicot, scientifically known as a eudicotyledon or eudicotyledonous plant, is a type of flowering…
Q: Consider a gram negative pathogen isolated from marine mammals. This pathogen is subjected to a…
A: Here in this question we are given certain characteristics and on the basis of it we have to…
Q: What is the size in µm of a cell that is 135mm wide in my photo? The scale bar in the photo is…
A: A microscope is a scientific instrument that allows us to see objects that are too small to be seen…
Q: Find an online image of Basidiomycota and Ascomycota Life Cycle (Asexual and Sexual Reproduction):…
A: Fungi are the unicellular Eukaryotic group of animals which are heterotrophic in nature. Their cell…
Q: Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the…
A: Point mutation Point mutation is a type of mutation in which there is a change in the single base…
Q: bottleneck effect gene flow founder effect sexual selection 1. As habitats change, populations of…
A: Evolution is a natural process occurring continuously in nature, It involves adaptation of the…
Q: is i 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT Ċ (c) wha 3' 5' se that…
A: Transcription is a process in which mRNA is synthesized with the help of DNA by the help of the…
Q: In pea plants yellow seed color, (GG) and round seed shape (WW) seeds are dominant traits, while…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: Fungi are a group of microorganisms that belong to the kingdom Fungi. They are eukaryotic organisms,…
Q: 2.3. Locomotor and Bladder Function Locomotion scores in all dogs gradually increased with the…
A: In Figure 3, the gait ability and locomotion scores for four dogs are presented:
Q: Identify the correct features by dragging the labels/descriptions to their correct targets A…
A: Cell is the basic structural and functional unit of life. All living organisms are made up of cells.…
Q: Draw the basidium and spore at the top (usually 4 per basidium). (Coprinus mushroom sporangia)
A: A basidium is a small sporagium which is a reproductive structure that is present on the hymenophore…
Q: homodimers
A: Based on the oligomeric states of proteins, are classified as homodimers, homotrimers and…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: Fungi are a group of microorganisms that belong to the kingdom Fungi. They are eukaryotic organisms,…
Q: How many atp are formed from Nadh and fadh in metabolism and why does the number of atp vary?
A: Cellular respiration is the process that is responsible for the production of energy by the…
Q: A female Drosophila fly is heterozygous for three recessive pigmentation mutations called pl, bk,…
A: The scenario presented involves an exploration of genetics using Drosophila or fruit flies. In this…
Q: 1. Draw the label cardiac muscle tissue as you observed it at medium magnification. 2. Draw and…
A: Muscles contract to contribute to both gross and fine movements, enabling actions such as walking,…
Q: What is osteoarthritis
A: The skeletal system is the support system of the body that provides shape and structure to the body.…
Q: If interference is complete (i.e., 100% effective), what is the frequency of double crossovers one…
A: Interference is defined as Inhibition of further cross over events by a crossover event in a nearby…
Q: Which codons do not have a matching tRNA? Select all that apply O UAA O AUG OUGA UGG OUAG
A: Transfer RNA (tRNA) is defined as a subclass of RNA molecules which is essential for the translation…
Q: A very common molecular biology research method is to analyze cell or tissue homogenates by…
A: In molecular biology research, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting,…
Q: Which of the following is an advantage of asexual reproduction? (choose all correct answers)…
A: Asexual reproduction is a type of reproduction in which an organism gives rise to offspring having a…
Q: genes, gene density, and number of exons. Prokaryote one gene every 2000 to 100000 bp mly large,…
A: Prokaryotes are the microorganisms which are usually unicellular and they are devoid of any membrane…
Q: See image
A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: The electron transport system in bacteria involves: a proton motive force and oxidative…
A: The electron transport system, also known as the electron transport chain (ETC), is a vital process…
Q: Which of the following statements is TRUE about the topologies of the trees shown below? All four…
A: A hybrid network architecture known as a tree topology, or star-bus topology, connects star networks…
Q: You are a microbiologist, you were using spread plate counts to quantify the effects of a new…
A: The spread plate count is a microbiological technique used to determine the concentration of…
Q: The image attached is a drawing of a Columnar Epithelium slide with the 40x objective lens. There…
A: The lining of the digestive tract (stomach, small intestine, and large intestine), the respiratory…
Q: What letter in the diagram identifies the sporophyte? Which letter in the diagram indicates the…
A: The diagram illustrates the alternation of generations, a common life cycle observed in many plants…
Q: Give typed full explanation Which of the following results in the production of ATP from ADP? a.…
A: ATP is adenosine triphosphate which is the source of energy for the use and storage at the cellular…
Q: his is an image of a long bone. Identify "3" 1 4 5 6
A: Answer :- In these questions, we are asked to identify specific parts of a long bone from provided…
Q: Which of the following include the correct order of phases of a typical bacterial growth curve? log,…
A: Microorganisms grown-up in closed culture also called as a batch culture in that no nutrients are…
Q: What is the 260/280 ratio when quantifying DNA? select the correct option below A. ratio of protein…
A: Deoxyribonucleotides are joined together by phosphodiester bonds to produce DNA, also known as…
Q: Check All That Apply: Products of the Calvin cycle include: NADP+ Pi ADP glyceraldehyde-3-phosphate…
A: The Calvin cycle is a crucial biochemical pathway that plays a fundamental role in photosynthesis,…
Q: What is the purpose of the fruit we (and other animals) eat, from the plant's perspective? Group…
A: A fruit is the mature ovary of a flowering plant, typically containing seeds. It develops from the…
Q: Based on these graphs, and assuming head raises of European finches helps watch for predators but…
A: The first graph (a) depicts the relationship between the total head raises of the flock per minute…
Q: You mention is it beneficial to train in high altitudes. Which physiological changes occur in the…
A: It is also known as hypoxic training. It is referred to as training in high altitudes. This can…
Q: Viruses without borders" is what it means? What's the reason that viral infections are going up as…
A: Viruses without borders" means that viral infections don't respect geographical boundaries. They can…
Q: Bacteria can grow under a variety of conditions but also have growth preferences. Bacteria that…
A: The need for oxygen may be used to categorize different types of microorganisms. The way that…
Q: A simple diagram indicating the alterations in genetic content throughout mitosis could be prepared…
A: Mitosis is the cell division process that is responsible for the production of two diploid (2n)…
Q: Zygote Cleavage (Blastula) Cleavage (8-cell stage) Early Gastrula
A: The development of an organism begins after the fertilization process. Fertilization involves fusion…
Q: what does the second number in the chromosomal location indicate like the number right before the…
A: It is the specific location of the gene which provides for information of the particular segment of…
Q: The genetics research lab has sequenced a genomic region with 1000000 basepair of an unknown…
A: The effective population size (Ne) of a species is the number of individuals in an idealized…
Q: edigree and determine which of the following modes of inheri ait: dominant recessive minant essive…
A: A pedigree is made on different modes of inheritance that could be autosomal or sex linked.…
Q: Tendel's Law of Independent Assortment? Explain your reasufillig in your own words. AB Ab aB ab AB…
A: In the Punett square a dihybrid cross is shown where two traits are considered at a time. Each…
Q: A rare recessive trait, when exhibited in men, is transmitted to half of their daughters and none of…
A: Genetic disorders are caused due to variants, or mutations in a single gene. These disorders are…
Q: Give typed full explanation
A: This is a kind of a bone attached to a joint. A large cavity can be identified in this arrangement.
Q: the A and the S alleles are co-dominant. What is the phenotype of a heterozygote (AS)?
A: Codominance is a genetic concept where two different alleles of a gene are equally expressed in a…
Q: Calculate the generation time given the following population data: Ro= 0.601, r = -0.05, Exlxmx =…
A: The generation time of a population is a key parameter in understanding its growth dynamics. It…
Q: Name and describe 5 properties of cancerous or tumor cells from patients(in vivo) and of cancerous…
A: Cancerous cells are abnormal cells that grow uncontrollably, invade surrounding tissues, and can…
What would happen if there is an increase of acetylcholine and serotonin receptor activation in the body?
Step by step
Solved in 4 steps
- The following diagram represents a typical serotonergic synapse. Where, specifically, do antidepressants work (e.g. SSRI)? Neurotransmitter Neurotransmitter transporter Аxon Synaptic vesicle terminal Voltage- gated Ca?+ channel Synaptic cleft Receptor Postsynaptic density Dendrite Neurotransmitter Synaptic Vesicle Neurotransmitter transporter (aka Reuptake transporter) Receptor O All of the aboveReserpine is a drug that can control high blood pressure by reducing the number of catecholamine neurotransmitters present in the synapse. Epinephrine, norepinephrine, and dopamine are examples of catecholamine neurotransmitters. One of the known side effects of reserpine is to cause the symptoms of Parkinson’s disease. Parkinson's disease is associated with dopamine. Parkinson's disease occurs when the nerve cells in the part of the brain that controls muscle movement are gradually destroyed and the neurons can no longer produce dopamine to coordinate muscle movements. Reserpine causes symptoms by a. inhibiting the release of dopamine from the presynaptic neuron b. blocking the dopamine receptor in the postsynaptic neuron c. breaking down the neurotransmitter acetylcholine in the synapse d. breaking down cholinesterase enzyme in the synapseImagine that a new type of psychoactive drug has been developed in a laboratory. It works by slowing the reuptake of dopamine in some brain circuits, increasing the amount of dopamine in the synapse. It also blocks serotonin binding in other brain circuits. Based on only this information, you can conclude that this new psychoactive drug is a: dopamine and serotonin antagonist. dopamine antagonist and serotonin agonist. dopamine and serotonin agonist. dopamine agonist and serotonin antagonist.
- A patient has been exposed to the organophosphate pesticide malathion,which inactivates acetylcholinesterase. Which of the following symptoms would you predict: blurring of vision, excess tear formation, frequent or involuntary urination, pallor (pale skin), muscle twitching, orcramps? Would atropine be an effective drug to treat the symptoms?(See Clinical Impact 16.2 for the action of atropine.) Explain.Parkinson's Disease Parkinson's disease is a neurological degenerative disorder that affects movement. Most people affected with Parkinson's disease demonstrate rigidity, slow movement, and shaking. The symptoms of Parkinson's disease occur when the cells that produce dopamine neurotransmitters die in the brain. Since most symptoms of Parkinson's disease are caused by insufficient dopamine in the brain, many Parkinson's drugs either temporarily replenish dopamine or mimic the action of dopamine. Explain how the signal transmission at a synapse in an individual with Parkinson's disease is different than an unaffected individual. 1. List the steps involved in an action potential moving from the axon terminal of the pre-synaptic neuron to the dendrites of the post-synaptic neuron. 2. Explain how the process is different in individuals affected with Parkinson's disease.Is atropine a competitive or a non-competitive antagonist of acetylcholine-induced responses? How did you reach this conclusion?
- Multiple sclerosis (MS) is a disorder that causes the destruction of myelin sheaths surrounding neurons. People with MS display many symptoms, including slurred speech, double vision, and poor muscle coordination. What is the direct effect of MS on nerve impulse transmission? Select one: The movement of impulses along neurons is slower than normal. Dendrites cannot be stimulated by acetylcholine, therefore impulses are not generated in neurons. The threshold level of stimulation for neurons is greater than normal. Axons cannot sectete acetylcholine, therefore impulses are not able to travel across synapses. OJohn Hughes and Hans Kosterlitz identified the endorphin receptor in frogs, and concluded that animals have a "built in" opioid system. To make sure that endorphins are truly neurochemicals, which of the following question should we ask these gentlemen? Please select all that apply.a) Are endorphins released in response to presynaptic depolarization? b) Do endorphins interact with postsynaptic receptors? c) Are endorphins found in presynaptic cells? d) Are endorphins subject to reuptake?Parkinson's Disease Parkinson's disease is neurodegenerative disorder that affects movement. Most people affected with Parkinson's disease demonstrate rigidity, slow movement, and shaking. The symptoms of Parkinson's disease occur when the cells that produce dopamine neurotransmitters die in the brain. Explain how the signal transmission at a synapse in an individual with Parkinson's disease is different than an unaffected individual. Describe the normal process of signal transmission at a synapse. Start with the arrival of an action potential at the axon terminal and include the name of the neurotransmitter that is affected by Parkinson's disease. Explain how the process is different in individuals affected with Parkinson's disease.
- Which of the following statements is true? Chemical messengers within cells are always the main determinant of the effector response. Dual innervation is always present in all organs and glands; one branch enhances the function or secretion, while the other branch inhibits it. The beating of the heart is regulated only by the sympathetic division. Some blood vessels contain alpha adrenergic receptors that cause vasoconstriction in the presence of epinephrine, whereas others have beta adrenergic receptors that cause vasodilation in the presence of epinephrine.If incoming serotonin axons were destroyed, LSD would still have its full effects. However, if incoming dopamine axons were destroyed, amphetamine and cocaine would lose their effects. Explain the difference.If a newly-developed drug is found to bind to acetylcholine receptors but does not activate them, the drug is classified as an agonist. True or false?