What will be the phenotypic ratio of the offspring of a purebreed male fly with eosin eyes (CCXw-eY) mated to a red-eyed female who is heterozygous for both the cream (C) and eosin eyes (Xw-e) allele
Q: Question 12 Which of the following are true about the properties of enzymes? (select all that apply)…
A: Enzymes are proteins that act as biological catalysts by accelerating chemical reactions.
Q: In the CNS which ones are the most common morphological synapse types active during synaptic…
A: The Neurons in the CNS receive thousands of synaptic inputs from other neurons. This information…
Q: What is Chemical Pollution and how can we prevent it?
A: Any undesirable, harmful, poisonous particle in the air is called pollution. These particles are…
Q: 3. For every 3 turns of the Calvin Cycle, 1 molecule of G3P (Glyceraldehyde-3-Phosphate) is…
A: Calvin cycle is the light-independent process of photosynthesis that fixes carbon dioxide. It…
Q: Anthrology of Joints Familiarize yourselves with the different joints of the body and label the…
A: Joint is a part of the body where two or many bones meet. They usually allow the movement of certain…
Q: Cnidarians do not have mesoderm. Discuss the costs and benefits of this condition, especially with…
A: Explanation: Cnidarians do not have a mesoderm layer in their bodies. Because of this state, the…
Q: 2. The volume of Ms. Rose's plasma was 3 L before Raphael administered the IV. Assume that there was…
A: Introduction Osmosis is the process by which water molecules pass through a cell's partly permeable…
Q: Chloride ions (Cl-) are in higher concentration outside of the cell compared to the intracellular…
A: Ion channels across the membrane allow the movement of specific ions in the cell and outside. This…
Q: Compare/contrast different types of cell junctions• Are they cell-to-cell or cell-to-extracellular…
A: The connection between cells is called cell junction. Cell junctions have any various kinds of…
Q: Which of the following processes and or mechanisms of evolution violate the assumptions of…
A: A population must satisfy five key suppositions in order to be in Hardy-Weinberg equilibrium, or a…
Q: Write a summary: Simply put, a lab report is a way to explain what you have done in an experiment.…
A: "Research" is the process of researching and evaluating many elements of a problem to find a…
Q: What trends you see in the data - Explain how the error bars support what you are saying - Why…
A: Life expectancy is the number of years a person is likely to live after reaching a certain age, as…
Q: Based upon your understanding of electron transport and energy generation, explain the following…
A: Introduction An electron transport chain is a collection of protein complexes and other molecules…
Q: Identity gene 1 (bl, pr, vg) Identity gene 2 ( bl, pr, vg) Identity gene 3 ( bl,pr, vg) How many map…
A: The three point test cross is used in this table. The greater numbers are parental progenies. The…
Q: 9 10 11 Which term below is NOT directly related to the sensory system's ability to locate a touch…
A: The Nervous system is a collection of cells, tissues, and organs that are involved in sensing,…
Q: Columbia CNA with 5% Sheep Blood Agar is undefined, differential and selective. Which ingredient…
A: INTRODUCTION Columbia sheep blood agar This is the 5% sheep blood agar used for the isolation of…
Q: Describe protein coat assembly • Describe the role of Coat Recruitment GTPases (include coat…
A: Within a eukaryotic cell, transport vesicles constantly bud off from one membrane and unite with…
Q: Which eukaryotic initiation factor (elF) brings the initiator tRNA to the ribosome? elF1 1 O elF2…
A: The process by which the mRNA codes for a particular protein is known as Translation.
Q: Antibiotics are medicines that are used to fight bacterial infections. These medicines kill…
A: Antibiotic is a medicine that inhibits the growth of microorganisms or destroys it.
Q: Why are vestigial structures among organisms evidence for evolution? Give an example of another…
A: The evolution of various organisms or life forms present on the earth shows that the organisms are…
Q: Explain why there is no arrow that shows carbon atoms gojng from the soil to the tree based on the…
A: Carbon cycle is the movement of carbon atoms from atmosphere into organisms and plants and back to…
Q: Describe the complete structure of the following organelles: nucleus, chloroplast, mitochondria
A: Every individual is madeup of cell a structural and functional unit of all organisms. Individual can…
Q: In the schematic diagram of a eukaryotic cell below, which processes (I-V) listed below take place…
A: The process of copying DNA to RNA is known as transcription, and the process of using RNA to make…
Q: Severe vomiting and diarrhea cause a loss of water and solutes from extracellular fluids. If the…
A: Vomiting in diarrhoea results in loss of excess fluid from the body. Solution that is best for such…
Q: Do peptide bonds get protonated or deprotonated? Explain
A: Peptides are short chains of amino acids that are linked by peptide bonds. Chains of less than 20…
Q: 18. Mushrooms belong to which kingdom? O Kingdom Plantae Kingdom Fungi O Kingdom Eubacteria O…
A: Introduction The five kingdom classification was proposed by Robert Whittaker. According to the…
Q: Question 2: DNA repair enzymes preferentially repair mismatched bases on the newly synthesized DNA…
A: The mismatch repair mechanism recognizes and fixes base mismatches created during DNA replication…
Q: Describe the role/function of the coronary circulation.
A: Introduction Large and muscular in nature, the heart constantly pumps oxygen-rich blood to the brain…
Q: Parallel evolution, convergent evolution and character state reversals are all examples of Select…
A: Parallel evolution is the evolution of independent species, which share the same characteristics.…
Q: State one example of an emergent property. Describe how a feature of the whole is not observed in…
A: A property that develops as a result of joining individual elements or components into a system is…
Q: Choose only one which is the correct? Which of the following best describes a trait of life? a. A…
A: Carbohydrate They are the long chain of sugar molecules made up of carbon oxygen and hydrogen.
Q: 12. d) noltionos le ter Wonsmo color-blind A red-green man (sex-linked gene) marries a normal woman.…
A: Introduction: Simply said, colour blindness is the inability to see or distinguish between colours…
Q: Discuss the three ways by which natural products can be developed and utilized as drugs. which is…
A: Nutrients are substances that are required by the body for nourishment and growth. Depending upon…
Q: You collected 1000 mL of river water from the stream running through campus. You prepared dilutions…
A: Introduction A dense solution can be made into a more useful concentration by performing a series…
Q: 14 Average size of offspring produced (g) 12 11 10 13 2 4 6 8 Number of offspring produced O…
A: There is a certain relationship between the number of offsprings produced and the size of the…
Q: List the Five Kingdoms and give the distinguishing features of each kingdom, which ones are…
A: The living organisms are classified into different kingdoms based on there characteristics.…
Q: 1. Define "immunosenescence" "Senescence-associated secretory phenoty-e (SASP), and "inflammaging"
A: 1. Define "immunosenescence" "Senescence-associated secretory phenoty-e (SASP), and "inflammaging"
Q: We have 10 mL of cells to treat with Hydrogen Peroxide (H2O2), such that the final concentration of…
A: A stock solution refers to the concentrated form of chemical reagents which is diluted each time…
Q: Selfing changes genotype frequencies within populations. A) True B) False
A: Introduction :- A population's genotype frequency is calculated by dividing the number of people…
Q: Which are the organisms in one of the food chains in this food web? Who is the producer in the…
A: In biodiversity, a food chain contains different kinds of organisms from producers to consumers.
Q: The largest cycloneuralians are also the only ones with external fertilization. Which phylum is…
A: * Cycloneuralians belongs to the clade of ecdysozoan animals which consists of Scalidophora and…
Q: Where did you get the table chi square value of 3.84 from?
A: Chi square It is the statistical test to compare the values of expected result with observable…
Q: If you observe a selection coefficient of 0.025 against recessive homozygotes, what is the relative…
A: A "selection coefficient" quantitatively assesses one genotype's "relative fitness" to another. The…
Q: Linkage Mapping Using a Trihybrid Testcross in Fruit Flies Remember the black, purple, and vestigial…
A: Trihybris cross - It is the cross between the two individuals of a species for studying the…
Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…
A: In genomics, transcription is the process of creating an RNA copy of a gene's DNA sequence. This…
Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…
A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…
Q: Why do water-dwelling animals have thicker bones than land-dwelling animals?
A: Bones are the organs of support and form the part of skeletal system. These maintain the body shape…
Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…
A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…
Q: Approximately O 90 60 30 10 % of chromatin is actually composed of DNA.
A: Thread like coiled, elongated structure, present in nucleoplasm and stained with basic stain and…
Q: L. BOT2 and Etosha45 populations are on the same branch of the phylogenetic tree. Why do you think…
A: Phylogenetic trees represent evolutionary linkage between organisms represented in a tree form that…
What will be the
Step by step
Solved in 2 steps with 1 images
- The F1 flies described in question 1 were mated with brown-eyed flies from a true-breeding line. What phenotypes would you expect the offspring to have? (a) all with red eyes (b) all with brown eyes (c) half with red eyes and half with brown eyes (d) red-eyed females and brown-eyed males (e) brown-eyed females and red-eyed malesA true breeding male fly with eosin eyes (CCXw-eY) is crossed to a red-eyed female who is heterozygous for both the cream (C) and eosin eyes (Xw-e) allele. What will be the phenotypic ratio of their offspring?PURPLE VESTIGIAL DIHYBRID CROSS In the parental generation, you mate a pure-breeding wild-type female (put/pu+;vg+/vg+) with a pure-breeding purple, vestigial (pu/pu;vg/vg) to produce an F1 generation that is all wild-type (pu*/pu;vg+/vg). Note that the F1 flies are all dihybrid. Next, you mate several F1 dihybrid females (pu*/pu;vg+/vg) with tester males, which are purple, vestigial (pu/pu;vg/vg). The offspring of this dihybrid testcross are: Phenotype Genotype Tester Gamete Dihybrid Gamete Number Wild-type 437 417 77 59 Purple, vestigial Vestigial Purple Copy the table into your notes and derive the dihybrid gametes following the example in the first section. The columns in blue (phenotypes and numbers of offspring) are what you can see and count. The genotypes of the testcross offspring (orange) must be deduced from the phenotypes and knowing that the tester contributed pu vg gametes. Finally, you can deduce the dihybrid gametes (green) by subtracting the tester gamete contribution…
- BLACK VESTIGIAL DIHYBRID TESTCROSS In the parental generation, you mate a pure-breeding wild-type female (bl+/blt.vg+/vg+) with a pure-breeding black, vestigial (bl/bl vg/vg) to produce an F1 generation that is all wild-type (bl+/bl vg+/vg). Note that the F1 flies are all dihybrid. Next, you mate several F1 dihybrid females (bl+/bl vg+/vg) with tester males, which are black, vestigial (bl/bl;vg/vg). The offspring of this dihybrid testcross are: Phenotype Genotype Tester Gamete Dihybrid Gamete Number 440 Wild-type 394 108 135 Black, vestigial Vestigial Black Copy the table into your notes and derive the dihybrid gametes following the example in the previous section. The columns in blue (phenotypes and numbers of offspring) are what you can see and count. The genotypes of the testcross offspring (orange) must be deduced from the phenotypes and knowing that the tester contributed bl vg gametes. Finally, you can deduce the dihybrid gametes (green) by subtracting the tester gamete…In Drosophila, ebony body colour is produced by a recessive gene a and wild-type (gray) body colour by its dominant allele a+. Vestigial wings are governed by a recessive gene vg, and normal wing size (wild type) by its dominant allele vg+. If wild-type dihybrid flies are crossed and produce 256 progeny, how many of these progeny flies are expected in each phenotypic class?The non-wild-type alleles are k (clipped wings), l (long tail), and m (magical powers). The parental stocks are homozygous doubly recessive flies of genotype k+/k+ · l/l · m/m and homozygous singly recessive flies of genotype k/k · l+/l+ · m+/m+. From this cross, triply heterozygous progeny of genotype k/k+ · l/l+ · m/m+ are obtained, and females of this genotype are testcrossed to triple recessives of genotype k/k · l/l · m/m. The genotypes determining the eight progeny types from this testcross (CROSS C) are shown here with their numbers, out of a total sample of 1,572 flies. What is the correct order of the genes? What number of progeny for each genotype would you predict in the case of independent assortment? What is a non-recombinant genotype? What is a genotype of a single crossover? What is a genotype of a double crossover? What is the longest distance between any of the two dragon alleles above? What is the shortest distance between any of the two dragon alleles above?…
- A male fruit fly, heterozygous for both vestigial wings and ebony body, is crossed with a female homozygous for normal wings and heterozygous for ebony body. What fraction of their offspring will have normal wings and an ebony body?Forked bristles, miniature wings, and sable bodies are all homozygous recessive traits whose genes are located on the same chromosome. You cross female flies that have forked bristles (f) with male flies that have both miniature wings (m) and sable bodies (s). You then cross the F1 of this cross with flies that have sable bodies, forked bristles, and miniature wings, and obtain the following numbers of offspring with the following phenotypes out of a total of 1500 offspring: Sable bodies and miniature wings 463 Sable bodies and forked bristles 3 Miniature wings and forked bristles 49 Forked bristles, miniature wings, sable bodies 99 Miniature wings 5 Wild type 107 Sable bodies 55 Forked bristles…Forked bristles, miniature wings, and sable bodies are all homozygous recessive traits whose genes are located on the same chromosome. You cross female flies that have forked bristles (f) with male flies that have both miniature wings (m) and sable bodies (s). You then cross the F1 of this cross with flies that have sable bodies, forked bristles, and miniature wings, and obtain the following numbers of offspring with the following phenotypes out of a total of 1500 offspring: Sable bodies and miniature wings 463 Sable bodies and forked bristles 3 Miniature wings and forked bristles 49 Forked bristles, miniature wings, sable bodies 99 Miniature wings 5 Wild type 107 Sable bodies 55 Forked bristles…
- In the fruit fly, Drosophila melanogaster, a spineless (sp, no wing bristles) female fly is mated to a male that is claret (cl, dark eyes) and hairless (h, no thoracic bristles). Phenotypically wild type F1 female progeny were mated to fully homozygous (mutant) males and the following progeny (1000 total) were observed. PHENOTYPES NUMBER OBSERVED spineless 316 wild 8 claret, spineless 136 claret 37 claret, hairless 304 hairless, claret, spineless 12 hairless 144 hairless, spineless 43 - A.…The probability that both alleles in the offspring are type A is the product of the probability that the allele from the pollen is A and the probability that the allele from the ovule is A (we will derive this in Section 6.5). What is the probability that the offspring of a homozygous parent is homozygous? What is the probability that the offspring of a homozygous parent is heterozygous?Two plants in a cross were each heterozygous for two gene pairs (AB /ab) whose loci are linked and 30 map units (mu) apart. (Recall that 1 mu is equal to 1% recombination between two genes.) Assuming that crossing over occurs during the formation of both male and female gametes and that the A and B alleles are dominant, determine the phenotypic ratio of their offspring. Part E: What proportion of the offspring of two plants (both (AB/ab ) will be A - B- if the genes are 30 mu apart? Part F: What proportion of the offspring of two plants (both (AB/ab)) will be A - bb if the genes are 30 mu apart? Part G: What proportion of the offspring of two plants (both (AB/ab)) will be aaB- If the genes are 30 mu apart? Part H: What proportion of the offspring of two plants (both (AB/ab)) will be aabb if the genes are 30 mu apart?