what technique was used to figure out if some Tasmanian devils would be more likely to survive the transmissible cancer reducing their numbers? - RNA-seq - GWAS - de novo sequencing - deep sequencing
Q: Tell me how this image shows the relation between grape and banana
A: A phylogenetic tree's branching structure illustrates how many species or other groupings developed…
Q: Sahelanthropus tchadensis Anatomical structures/characteristics
A: Sahelanthropus tchadensis is the oldest known species in the human family record. This species lived…
Q: What is one important advantage of using environmental DNA (eDNA), instead of traditional…
A: The environmental DNA methodology provides a number of benefits over conventional surveying…
Q: A parent has the genotype PpLl for two independently assorting genes. What are all the possible…
A: According to Mendel's independent assortment law, the parent who has the genotype PpLl for two…
Q: 54. In eukaryotes, the location for transcription is A. On the plasma membrane B. Inside the nucleus…
A: The central dogma of molecular biology states that genetic information is passed on or flows in one…
Q: When using Endo agar as the selective and differential media for the confirmed test, how would you…
A: Endo agar differentiate gram negative bacteria on basis of fermentation of lactose, and inhibits…
Q: How many ATP molecules are overall produced in Glycolysis? 3 ATP 5 ATP 4 ATP 2 ATP
A: Question : How many ATP molecules are overall produced in Glycolysis ? Answer : 4 ATP molecules
Q: which of the following is peto's paradox? o despite having more cells ( and therefore more genome…
A: Cancer is a disease that causes uncontrollable cell division. This occurs because of changes in the…
Q: The team would now like to establish the smallest possible deletion that would inactivate the…
A: Amino acid monomers form the building blocks of proteins. The arrangement of amino acids makes up a…
Q: Synthesis of new bacteriophages in a bacterial host involves the use of a.) Host cell encoded…
A: Phages that only infect bacteria are known as bacteriophages. Phage are available in a wide range of…
Q: Genome annotation refers to ... 1.) lining up overlapping regions in short shotgun sequencing reads…
A: Introduction:- Genome consists of all the genetic and biological information of an individual…
Q: The evolution of the highly complex eukaryotic cell was possible because.. A) Mesosomes released…
A: Correct answer is (B). Two different prokaryotic bacterial species entered the complex cells as endo…
Q: 1Which of the following is NOT a consequence of global climate change? coral bleaching more ice at…
A: Climate change can change the pattern of species interaction as well as how they live, and the…
Q: The transportation of fatty acids into the mitochondria for oxidation occurs by...... O Facilitated…
A: The carnitine shuttle, which is made up of the enzymes carnitine-palmitoyltransferase 1,…
Q: 1. Differentiate the genotype and phenotype of a cell. 2. If deoxyribonucleotides that lack the…
A: In an organism the genetic matter is present inside the genes present in the chromosome of the…
Q: 7. In the documentary titled: "Peter Singer: Dangerous Mind" Dr. Singer presented his position with…
A: The answer of this question is option D: Disabled infants don't have any right to life.
Q: If one nondisjunction event occurred during meiosis II, you would expect the four resulting gametes…
A:
Q: PINK LAMP2A BCL2 ATF6 [Choose] [Choose] promoting UPR promoting apoptosis inhibiting autophagy…
A: PINK1 gene gives instruction to form PINK 1 protein. Highest level of this protein is found in…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctqctc 61 tcggcggccc tggccctgac…
A:
Q: The functions of almost all of the genes in the lambda genome were first explored using mutations.…
A: Lambda is a bacteriophage virus capable of infecting of bacteria. The mature virus particle consists…
Q: When will arm span and knee height be used? Are there any limitations on using these two methods?
A: When the accurate measurement for stature is unobtainable, other surrogates are used to predict…
Q: Dichotomous Key Homework Use this Dichotomous Key and identify each of these seven leaves. You can…
A: Using the dichotomous key for the given leaves Following things can be concluded: (1):- It is a…
Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…
A: Cancer cells are abnormal cells that divide uncontrollably and have the ability to invade other…
Q: Signs and symptoms of Asthma in detailed
A: Introduction Your airways may swell, become more constricted, and create more mucus if you have…
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
Q: Use arrows to identify the transition of the type of epithelium, esophageal glands and gastic glands…
A: The stomach is a J-shaped organ in human body that helps in digesting food. It produces enzymes and…
Q: O Cats O Dogs O Elephants O Humans O Spiders (like Charlotte in Charlotte's Web)
A: Semelparity is a type of reproductive technique. It is opposite of iteroparity.
Q: Which of the following correctly lists mutation types in order from least likely to affect an…
A: A mutation occurs when the order of bases in DNA or RNA changes. Each person has a mutation. In…
Q: The prokaryote cell type is associated with the following structures EXCEPT? a) ribosomes,…
A: The prokaryotic cells are primitive cells which do not have distinct cellular organelles. The…
Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…
A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…
Q: .What is biomass as a source of energy? Is it considered as renewable source of energy?
A: Biomass energy is the energy which is generated by using living mass. Biomass is a renewable energy…
Q: which of the followimg would be found inside the nucleus of the structure shown on the diagram
A: the shown diagram is a animal cell that contains several organelle such as mitochondria , cytoplasm,…
Q: There are many metabolic pathways in a biological system, and it is critical to regulate these…
A: To increase or decrease end product output, single enzymes or all of the enzymes in a given pathway…
Q: Describe the pathogen that causes “The Flu”. What happens you get the flu and how did you most…
A: The flu spreads through respiratory droplets and aerosols. Typically, influenza is contagious from…
Q: Jean is the mother of Dani, Lelia, Jose and Pam. Alex could be the father, You use PCR analyze 2…
A: Agarose gel electrophoresis can be used for analyzing and sorting DNA fragments depending on size.…
Q: Use the Chain of Infection to describe Legionnaire’s disease
A: Introduction Legionnaire’s disease it is type of pneumonia caused by legionella bacteria. lung…
Q: The origin of the photosynthetic eukaryote took place when a engulfed by a later eukaryote with…
A: Two organelles - Mitochondria and Chloroplast have their own separate DNA and ribosomes. The DNA in…
Q: What generally happens to individual expenditure(private meaning for the individual person, not the…
A: To make health for all a reality, there is a need of individuals and communities who have access to…
Q: What is the name of an antibody from goat immunized with rabbit IgG raised against chicken gamma…
A: Goat IgG antibodies that are specific to rabbit IgG. Chicken gamma globulin is the main component of…
Q: all of his sons all of his daughters half of his daughters and half of his sons half of his…
A: X- inactivation or lyonization is a process in which one of the X- chromosome is inactivated in…
Q: A mysterious young man who calls himself Matthew has appeared upon the doorstep of Yel. Matt claims…
A: PCR or the Polymerase Chain Reaction is a molecular technique that is used to amplify desired DNA…
Q: Describe agglutination reaction test used to determine A, B , AB or O blood types. Must explain each…
A: A blood group is classified on the basis of antigens present on the surface of the RBCs. These are…
Q: 63. A student studying mutations found her amino acid chain was…
A: Genetic information is carried by genes to make proteins . Process includes:- I ) Transcription II…
Q: Briefly explain how you can determine the presence of coliform bacteria in a water sample.
A: Coliforms are a type of bacteria. These organisms are normally harmless to the species or hosts they…
Q: In eukaryotes, Cot DNA reassociation curves are not smooth. They have bumps. Why? What are the…
A: Genome of an organism can be defined as a sum total of all the genetic material present in it.Genome…
Q: Match the factor on the left with what it promotes on the right Mitogen Morphogen Death ligand…
A:
Q: Define what a pneumonia is, including what tissues are involved and what the consequences are for…
A: A bacterial, viral, or fungal infection of the lungs is known as pneumonia. Alveoli, the air sacs…
Q: What materials used for bioprosthesis heart valves (the chemically pretreated heart valves)?
A: Prosthetic valves are used to replace diseased or non-functional or dysfunctional heart valves. It…
Q: In a large, randomly mating population of frogs, the frequency of the allele for silver skin (s) is…
A: The Hardy-Weinberg equilibrium describes the frequencies of genotypes in a population that is not…
Q: need a full description of insulin pump and how can be effective on certain types of diabetes and…
A: Diabetes mellitus Or type II diabetes mainly occurs due to the deficiency of insulin secreted by the…
what technique was used to figure out if some Tasmanian devils would be more likely to survive the transmissible cancer reducing their numbers?
- RNA-seq
- GWAS
- de novo sequencing
- deep sequencing
Step by step
Solved in 3 steps
- Arrange the best steps to take to identify the gene and mutation that causes the lung cancer. Not all of the answers will be placed. Isolate tumor DNA lightly fragment the genome transfect the genome into mouse cell line determine shared transfected region repeat with small fragments and sequence the gene generate a cell line from the tumor sequence the tumor-cell genome isolate transformed colonies introduce transfected cells into a mouse Introduce the mutation in cell cultureWhy is DNA microarray an important tool and explain How is DNA microarray used in detecting cancer?Primer pairs of homo sapiens isolate breast cancer brca1 gene. Select the best primer pair then give 5 reasons why is it the best
- CRISPR-cas9 is a powerful technique for gene editing. Please place the stages of a CRISPR-cas9 gene editing workflow in the correct order from stages 1-9. Note, there is one incorrect, redundant answer. - Add green fluorescent protein gene sequence into plasmid to aid selection of correctly transfected cells.- Clonal characterisation (analysis of phenotype).- Synthesize DNA insert oligonucleotides.- Select for correctly gene edited cells (using antibiotic resistance and/or color production for example).- Transfect cells- Purify plasmids- Clone into CRISPR-cas9 expression vector.- Design a set of targeting sequences using algorithms.- Clonal isolation.- Sequence.How gene therapy can be used in treating cancers? Explain broadly.Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?
- 1) What are the limitations of targeted versus whole-genome or whole-exome profiling of cancer mutations? 2) What can you infer about mutations that are common to almost all of the cells in a tumor? 3) Summarize the high-level differences between the VCF and MAF file formats. 4) How do germline and somatic mutations differ in terms of their effect on cancer risk and prognosis?Please place the stages of a CRISPR-cas9 gene editing workflow in the correct order below. Note, there is one incorrect and state why? Sequence Select for correctly gene edited cells (using antibiotic resistance and/or colour production for example) Clonal isolation Synthesise DNA insert oligonucleotides Clonal characterisation (analysis of phenotype) Add green fluorescent protein gene sequence into plasmid to aid selection of correctly transfected cells. Transfect cells Clone into CRISPR-cas9 expression vector Purify plasmids Design a set of targeting sequences using algorithms.What is the advantage of using stem cells for genetherapy or gene editing?
- -What is DNA cloning? What is the common organism that the scientists use to do cloning (explain briefly how it is done) -What is Gene of Interest? -What are the ethical issues on Biotechnology?Cloned human embryonic stem cells would be useful for which of the following reasons: Group of answer choices They would be a useful step towards the goal of creating cloned human babies They would allow the creation of patient-specific, immunologically-matched ES lines so that patient's immune systems would not attack the stem cells they were treated with Following treatment with a restriction enzyme, they could be inserted into a useful vectorDO NOT COPY IN GOOGLE OR BARTLEBY QUESTION: - Are cells grown in the laboratory will function similarly when transplanted?