What mechanism will be used in the following dna changes a change in the structure of a base cause by a mitiguen in non dividing eukaryotic cell b change in dna sequence cause by a mistake made by dna polymerase c a thymine diner in the dna of an actively dividing bacterial cell

What mechanism will be used in the following dna changes a change in the structure of a base cause by a mitiguen in non dividing eukaryotic cell b change in dna sequence cause by a mistake made by dna polymerase c a thymine diner in the dna of an actively dividing bacterial cell

Name: What mechanism will be used in the following dna changesa change in th
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What mechanism will be used in the following dna changesa change in the structure of a base cause by a mitiguen in non dividing eukaryotic cell b change in dna sequence cause by a mistake made by dna polymerase c a thymine diner in the dna of an acti

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter17: Bacterial And Viral Genetics

Section: Chapter Questions

Problem 5TYK

See similar textbooks

Similar questions

Reverse transcriptase assembles an ________ on an _______ template. a. mRNA; DNA c. DNA; ribosome b. cDNA; mRNA d. protein; mRNA
Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. Analyse this DNA fragment and answer the questions 1-5 that follow. +1 -10 -35 3' TTGCATCCGAAACGTACGATCGATESGCCGACTTATTACGATCGGACTACTGCGTCGTAGC5' 5' AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATCACGCAGCATCG3' ... ... Provide a brief statement in the space provided 1. What is the name if the TATTA sequence at -10 ? 2. What is the purpose of the -10 and -35 sites 3. What do you understand by the +1 site 4. Write the letters for the bases of the first 6 nucleotides of the mRNA molecule transcribed from this gene. Indicate the 5' and 3' end in your answer
Transfer of a donor chromosome fragment by a bacteriophage is defined as O Transduction O Budding O Conjugation O Transformation
Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.
3 E D C The arrow in the diagram below indicates the direction of movement of the replication fork. 5' S R F Q Search Which letter indicates a strand that is synthesized discontinuously? OA Ов ос V A F5 T C G B F6 T 6 Replication B LDL Y F7 H & 7 WALLS U N F8 * 00 99+ 8 J₁ F9 kirimmi MO 35 Alt מם E K 2 F10 L P < F12 10:05 AM 4/8/2023 Ctrl 10 B
Why are Gyrase inhibitors good antibiotics to use therapeutically? DNA Gyrase is required by prokaryotes, but not eukaryotes, to complete chromosomal replication so it's a good target to inhibit. O DNA Gyrase is required by eukaryotes, but not prokaryotes, to complete chromosomal replication so it's a good target to inhibit. It's impossible to develop resistance against Gyrase inhibitors so they are always effective. O DNA Gyrase is required by both prokaryotes and eukaryotes to complete chromosomal replication so it's a good target to inhibit.
Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5'
Which kind of chemical damage is depicted in this picture: 2-OH Ostrand breakage Obase deletion Obase modification O base cross linking is in
The process of transferring DNA from one bacterium to another through a bacteriophage is called O conjugation O the lysogenic cycle O transformation O transduction O the lytic cycle 0|00
Considening the structure of DNA, what kind of bonds hold one nucleotide to another within one side of the DNA molecule? O hydrogen O phosophodiester O lonic peptide
Which of the following is Not correct about Okazaki fragments? 青 they are synthesized by addition of RNA bases O produced in lagging strand DNA synthesis from 5' to 3' they joined together by DNA ligase their synthesis direction is away from replication fork In heterosporous plants:
Discuss DNA replication of prokaryotes and please mention all of the enzymes and components listed below. DNA Primase – DNA directed “RNA Pol” which inserts nucleoside triphosphates (NTPs) Primers are oligonucleotides; priming process is the formation of primers DNA Helicase – separates the DNA in advance of the replication fork (in E. coli DNA Helicase II); binds at AT-rich region of DNA; ATP then binds the helicase Single-stranded DNA-binding Protein (SSBP) – no enzymatic activity; does not consume ATP Topoisomerase – alter the supercoiling of double-stranded DNA DNA Ligase – nicking of strands done for replication to continue Okazaki fragments DNA Polymerase – removes primer via 5’ to 3’ exonuclease activity; comes again for 5’ to 3’ polymerization activity (closes the gap between Okazaki fragments) Prokaryotes DNA Pol I – auxiliary enzyme to DNA Pol III; repairs damage; capable of excising pyrimidine dimers; polymerization via single active site that can bind all 4 dNTPs;…