Use the codon table to determine one possible DNA sequence that corresponds to the following amino acids:methionine(Met), tryptophan(Trp), and lysine(Lys), alanine (Ala).In other words, what would the DNA sequence be that would yield the amino acid sequence above. Show yourwork.Second base of codonUCAVOUUCUUAUUGUUUCJUCCUACUGCUUAUCAUAAUGAUUGUCGUAGUGGCUUCCUCAUCGUCUCCCCCACCGCCUACCACAACGACUGCCGCAGCGGAUUACUAAUAGUAUC ACC>SarAACJAGCAUAACAAAAAGAAUG Met ACGAAGAGG NgGUUGCUGAUGGUGUCGCCGACGGCValGUAGCAGAAGGAGUGGCGGAGGGGFirst base of codonUPheLeu>LeuSer>ProThrAlaTyrHisGinAsnLysAspOysTroArg5MOA SIAV9ACUAThird base of codon

A sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a specific amino…

Use the codon table to determine one possible DNA sequence that corresponds to the following amino acids: methionine(Met), tryptophan(Trp), and lysine(Lys), alanine (Ala). In other words, what would the DNA sequence be that would yield the amino acid sequence above. Show your work. Second base of codon U C A UUU UAU UGU U UUC UAC UGC C UUA UAA UGA UUG UAG UGG CUU CAU CGU CUC CAC CGC CUA CAA CGA CUG CAG CGG AUU AAU AGU AUG AAC AGC AUA AAA AGA AAG AGG. GAUT GGU GAC GGC GAA GGA GAG GGG First base of codon U C A GUU GUC GUA GUG UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA Met ACG GCU GCC Val 6CA GCG Phe Leu Leu Ser Pro 2 4 Tyr His Gin Lys Asp 2 Cys Trp Arg Ser Arg 2 U 406 VGA Third base of codon

Use the codon table to determine one possible DNA sequence that corresponds to the following amino acids: methionine(Met), tryptophan(Trp), and lysine(Lys), alanine (Ala). In other words, what would the DNA sequence be that would yield the amino acid sequence above. Show your work. Second base of codon U C A UUU UAU UGU U UUC UAC UGC C UUA UAA UGA UUG UAG UGG CUU CAU CGU CUC CAC CGC CUA CAA CGA CUG CAG CGG AUU AAU AGU AUG AAC AGC AUA AAA AGA AAG AGG. GAUT GGU GAC GGC GAA GGA GAG GGG First base of codon U C A GUU GUC GUA GUG UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA Met ACG GCU GCC Val 6CA GCG Phe Leu Leu Ser Pro 2 4 Tyr His Gin Lys Asp 2 Cys Trp Arg Ser Arg 2 U 406 VGA Third base of codon

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read this question carefully also? Are you certain? (You may list the three letter abbreviations for the amino acids listed below) DNA Sequence: TAC AAG CCC TAG GCG ATA АТС [a] Table 1. MRNA codons & associated amino acids Second base C G UUU Phe UUC UCU UAU UGU U Тyr UAC Cys UGC UCC Ser UCA UAA Stop UGA Stop A UUA Leu UUG UCG UAG Stop UGG Trp G CUU CCU CAU] His CAC CGU CUC C CUA CGC Leu Pro CCA Arg CGA CAA Gin CUG CCG CAG CGG AUU ACU AAU Asn AAC Thr AAA Lys AAG AGU Ser AGC AUC Ile ACC AUA AGA Arg AGG ACA AUG Met or start ACG GUU GCU GAU GGU Asp GAC U GÚC GCC Ala GCA GGC Val GUA Gly GAA GGA Glu GAG GUG GCG GGG G Cooriaht O Pearson Education. Inc Dublishina as Beniamin Cumminas First base (5' end) Third base (3' end)
Given the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'
The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASE
Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
Give the amino acid sequence with some little explanation please. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
No drawings just writing the answer a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?