TRNA and 5S RNA genes both have the following internal control region. BoxA BoxB BoxC
Q: In Lieberman's Test, what should you do to revert the change caused by the addition of water to the…
A: Liebermann's test is a confirmatory test for the detection of a phenol group. It is also employed in…
Q: Prepare a concept map connecting carbohydrate and lipid synthesis. Your map should include shared…
A: Carbohydrate metabolism : Carbohydrates are the most abundant molecule defined as a poly hydroxy…
Q: residues listed below: (a) Ser195 (b) His57 (c) NH groups of Gly193 and Ser195
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: Give the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle.…
A: The Krebs cycle, or citric acid cycle, occurs in the mitochondrion of a cell. The citric acid cycle…
Q: In a reverse phase chromatography set up, the component that yields the lowest Rf value is likely to…
A: Reverse phase chromatography: The chromatographic technique that uses the hydrophobic stationary…
Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…
A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.
Q: 4. During a lunch at a MeDonald's outlet, an office employee received about 350 g of carbohydrates…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Q: What are massive, insoluble, high molecular weight compounds that have brown color? Not…
A: The brown pigment observed in different foods such as cookies, breads etc is the result of a…
Q: 9. L-lactate dehydrogenase: L-lactic acid:: Salivary a-amylase: a) D-aminoacid b) L-aminoacid c) a-…
A: All biological chemical reaction reactions in living beings are controlled by enzymes. If enzymes…
Q: 2. You want to clone a specific PCR amplicon. You have determined that the amplicon you want to…
A: pUC57 is a commonly used plasmid cloning vector in E. coli.
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: In the last 40 years, scientific understanding of retroviruses has increased dramatically. The word…
Q: What Type of guard column, separation column, and suppressor used for anion- exchange chromatography
A: In the anion-exchange chromatography, the process of separation occurs which is based on the charges…
Q: 5- Draw structure of products in the following metabolic reactions and name the enzyr involved and…
A: Introduction: The drug metabolism is needed to convert non-polar lipophilic compounds into polar…
Q: considering mating a black hearing male Labrador dog (homozygous in both alleles) with black deaf…
A: According to the given question, the male is black hearing Labrador dog and is a type of a…
Q: What is tne value of VX P in tne Table 6? Table 6. Data on Volume-Pressure Relationship Trial volume…
A: Answer- The value of V*P is given below- Trial Volume (L) Pressure (atm)…
Q: CH,0-P-O C=o 0. CH;0-P-O CH,OH C=O Ó. HO-C-H H-C-OH H-C-OHO C-H ČH;O-P-O- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the process in which glucose is broken down to produce two molecules of pyruvate, ATP,…
Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…
A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…
Q: Please solve all part. 9. If 32p-labeled inorganic phosphate were…
A: Glycolysis is undergoing here i.e conversion of the glucose to pyruvate molecules, and we assume…
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…
A: DNA replication being very complex process, there are chances of miss reading the DNA template and…
Q: In olfactory neurons, it is estimated that activation of the olfactory receptors results in an…
A: The olfactory epithelium of the nasal roof contains olfactory receptors. Each olfactory receptor is…
Q: A protein sample of unknown concentration was placed in a cuvette with a path length of 1 cm and the…
A: The concentration of a protein is directly proportional to the amount of light it absorbs. The…
Q: In the RBCs of the patient described above, which of the following would be expected? And give the…
A: Pyruvate kinase enzyme deficiency typically can manifest clinical symptoms on red blood cells…
Q: How would you develop an assay for soybean trypsin inhibitor and use it to test products??
A: Trypsin inhibitor: Also known as serine protease inhibitor i.e serpins inhibitors control the…
Q: Insulin Glucagon Glycolysis Hexose monophosphate pathway Gluconeogenesis Glycogenolysis
A: Insulin is a hormone made by our pancreas. It controls the amount of glucose in our bloodstream at…
Q: . Adding as little as 0.1 mL of concentrated HCl to a liter of H20 shifts the pH from 7.0 to 3.0.…
A: Acetic acid and sodium acetate is an example of the acid - base buffer, in order to understand how…
Q: Briefly describe "Lipids" and give examples
A: Lipids biological macromolecules non-polar molecules that is consist of hydrocarbons. It is soluble…
Q: HN-CH- HN-ÇH-C- -OH HN- CH 1 2 3.
A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…
Q: please name and characterize the enzym class according to the given rraction C=O 0. CH ČH-OH C=O Ó.…
A: The given molecule is fructose-1,6-bisphosphate which is broken down to glyceraldehyde-3-phosphate…
Q: DNA scissors used in genetic engineering applications are called Endo nucleases Restriction enzymes…
A:
Q: Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a…
A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β-…
Q: Fill out the table below. Determine whether the rate of the metabolic pathways will increase or…
A: Regulation of blood glucose is largely done by endocrine hormones , through a negetive feedback…
Q: 3. Do enzymes act better under acidic or alkaline pHs?
A: Most favored pH value - the pH point where the enzyme has most activity - is known as the optimum…
Q: Why most of the clinical features of the diseases Krebs Cycle inborn errors ( a- ketoglutarate…
A: Krebs cycle : This pathway plays an important role in the living cell metabolism also known as…
Q: does glycosides reduce Fehling’s reagent themselves? Explain your answer.
A: Glycosides are molecule which is composed of a sugar molecule bound to another functional group via…
Q: You receive a tube containing 18.8 nmol of lyophilized (freeze dried) primers to be used in PCR. How…
A: Primers are a short nucleic acid sequence that provides a starting point for DNA synthesis. I…
Q: hat are the components of Water? Explain and show some illustration
A: Introduction: For the existence of all living things, water is very essential. Without water, one…
Q: HbA1c is a glycated hemoglobin in which a glucose molecule is covalently bound to the N-terminal…
A: Hemoglobin is an iron-containing oxygen-transport metalloprotein found in nearly all vertebrates'…
Q: 5. Protein tyrosine phosphatase-1B (PTP1B) is an important enzyme regulating insulin signaling be-…
A: PTP1B enzyme in question catalyze the hydrolysis of phosphorylated tyrosine on Insulin receptor and…
Q: Table of BSA solution absorbance of concentration at 595nm. BSA Concentration (µg/ml) OD595nm Mean +…
A: Protein concentration is measured or determined using the reference standard curve. Proteins are…
Q: Gierke disease (glycogenosis) arises in the inherited defect of glucose-6- phosphatase and is…
A: Glucose is the primary source of energy for the body, which is metabolized through the glycolytic…
Q: Describe the process of DNA replication, including the enzymes involved (85%), and give two examples…
A: DNA replication is a process of duplication of genetic material during the process of cell division…
Q: how allosteric regulation is fundamentally different from competitive/uncompetitive/mixed inhibition…
A: Some categories of enzymes exhibit kinetic properties that cannot be studied using Michaelis-Menten…
Q: 5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b)…
A: Group specificity : Enzyme will catalyze the reaction on a function group of different molecules…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Draw the two amino acids serine and alanine, and a dipeptide that could be formed by combining these…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. Coenzyme b.…
A: The non-protein factors that are necessary for activity of some enzymes are called cofactors.
Q: Why is DNA not RNA the storage for genetic information?
A: DNA : Deoxyribonucleic acid is a genetic material for the storage of information. The structure of…
Q: 3. How do erythrocytes produce ATP? What is the role of ATP to red-cell morphology and function
A: Adenosine triphosphate (ATP) is an energy-carrying molecule particularly found in the cells of all…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Translation is a process of Synthesis of polypeptide chain from mRNA template by using Ribosomes. It…
15
Step by step
Solved in 2 steps
- Group I and II introns are present in the following classes of RNAS. MRNAS O MIRNAS SİRNAS TRNASWhich of the following is not true? There are two major classes of aminoacyl-tRNA synthetases The selectivity of the aminoacyl-tRNA synthetases for their tRNA molecules is often called the second genetic code A single activating enzyme can interact with all the tRNAs for its corresponding amino acid aminoacyl-tRNA synthetases link amino acids to tRNA molecules without the need for an energy sourceLabel the following regions on this tRNA molecule, stating the function of each:
- What would happen if you changed the anticodon in the Tryptophan tRNA from ACC to AAC? First letter U C A G U UUU Phe UUC Phe UUA Leu UUG Leu CỰU Leu CUC Leu CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met GUU Val GUC Val GUA Val GUG Val Second letter C A UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu G UGU Cys UGC Cys UGA Stop UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg GGU Gly GGC Gly GGA Gly GGG Gly O Tryptophan would be incorporated into peptides where leucine normally goes Tryptophan would be incorporated into peptides where it normally goes ○ Leucine would be incorporated into peptides where Tryptophan normally goes O Histidine would be incorporated into peptides where Leucine normally goes U C A G U C A G U C A G U C A G Third letterMatch the regulatory RNA to each of the following descriptions. Regulatory RNA that prevents transcription by recruiting DNMT enzymes Regulatory RNA that prevents translation by acting either in cis- or trans- but not by binding RISC Regulatory RNA found only in eukaryotes that is not perfectly complementary to the target RNA [Choose ] [Choose ] [Choose ] antisense RNA siRNA IncRNA miRNA riboswitch <RNA polymerase in Escherichia coli normally synthesizes all of the following molecules except: RNA primers during DNA replication messenger RNA (mRNA) transfer RNA (tRNA) ribosomal RNA (rRNA) heterogenous nuclear RNA (hnRNA)
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
- TRNA also undergoes post transcriptional modifications. True FalseIn this chapter you were introduced to nonsense suppressor mutations in tRNA genes. However, suppressormutations also occur in protein-coding genes. Using thetertiary structure of the β subunit of hemoglobin shownin Figure 9-3(c), explain in structural terms how a mutation could cause the loss of globin protein function. Nowexplain how a mutation at a second site in the same protein could suppress this mutation and lead to a normalor near-normal protein.Match each of the following descriptions to the type of regulatory RNA affecting a "target" gene (aka, the gene the regulatory RNA is regulating). Use each answer once. This regulatory RNA may increase siRNA transcription of the target gene by recruiting activator proteins. secondary structures on RNA can become... IncRNA these regulatory RNAs regulate gene miRNA expression post transcriptionally generally by binding to the 3'-UTR regions of their target RNAs > >