Q: Identify the type of mutation that occurred to produce the abnormal hemoglobin. Explain why you…
A: Nonsense mutation: This is a condition in which a protein loses its function, resulting in sickness…
Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?
A:
Q: What are frameshift mutations with an example
A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…
Q: Why isn’t cDNA synthetic
A: INTRODUCTION Deoxyribonucleic Acid, or DNA, is a molecule that holds the instructions that an…
Q: What do you mean by lysozyme gene?
A: Lysozyme gene is a protein coding gene.
Q: Difference between red-labelled and green-labelled cDNA preparations.
A: Difference between red-labelled and green-labelled cDNA preparations.
Q: 45. Why are topoisomerase inhibitors excellent drugs? How is it possible to use agents that block…
A: Topoisomerases are nuclear enzymes which participate in DNA supercoiling (overwinding or unwinding).…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: ⦁ Original: ATTTGAGCC Mutated: ATTGAGCC. This is an example of what kind of mutation?
A: The alteration, damage, or change in the gene of DNA occurs which can change the genetic information…
Q: occur as a result of biotransformation
A: The process of chemically changing the compounds inside the body from one compound to a different…
Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both
A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…
Q: how to identify mutant genes molecularly bytransformation
A: Transformation is the horizontal gene transfer by which some bacteria can take up foreign genetic…
Q: Identify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG…
A: Original Sequence: GGC TAC ATG GAAMutated Sequence: GGC TAA TGG AA
Q: Could you please explain to me what the following terms mean; “methylase”, “methylates” and…
A: Methylase: it is an enzyme that causes methylation, addition of methy group (CH3) on the substrate.…
Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…
A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…
Q: _____ Mutants Are Useful in ______ the Order in Which Proteins Function.
A: Saccharomyces cerevisiaes, or baker’s yeasts, unicellular fungi are useful in understanding genetics…
Q: EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'…
A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…
Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…
A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…
Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…
A: There are 4 codons that specify the amino acid valine, demonstrating the genetic code is…
Q: In your own words, explain the term transposon tagging.
A: Transposons or jumping genes are the sequences of DNA that are able to change their position within…
Q: ATCGTCA AGGCCTA ATCTCAA AGGCCT A Original Strand Mutant Strand Types of Mutation Explain/Why
A: Mutation:- Any alteration in the sequence of DNA that results in altered function or non-functional…
Q: What are some limitations in the use of ASOs for exon-skipping therapies in Duchenne muscular…
A: Duchenne Muscular Dystrophy (DMD) is a muscular disease caused by mutations in the dystrophin gene…
Q: How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!
A: Introduction :- DNA and RNA are made up of nucleotides, which are the basic building blocks of both.…
Q: 30) In the CRISPR system, the targeted DNA sequence is
A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Question 50 The presence of non-Watson base pair
A: A DNA repair mechanism is a group of processes that helps to correct the faulty or damaged DNA. This…
Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…
A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…
Q: 29. siRNA involves in: Gene degenaration Gene downregulation
A: Small interfering RNAs (siRNAs) are 20- 27 base pairs long double-stranded RNA molecules. It is a…
Q: EF-Tu: EF-Ts as ORF-1:RF2 eEF1A:eEF1B O Shine-Dalgarno:5'-7mG O Co-translation: post-translational…
A:
Q: Make me frameshift mutation
A: Any heritable alterations to the DNA sequence are known as mutations. Nucleotide substitution…
Q: Budding yeasts such as S. cerevisiae exhibit telomerase activity throughout their life cycles,…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: How many subunits does the E. coli DNA polymerase I have? Soloct onot
A: Option(d) 1
Q: EboV from Guinea pig Reference DNA Sample mRNA Protein
A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…
Q: Finding the Disease-Causing Mutation in Nic Volker’s Genome
A: Answer: Introduction: Young child Nicolas Volker failed to gain weight. Doctors at Wisconsin…
Q: TNIS IS the SC TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that…
A: Here DNA sequence is given is TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT This DNA strand work as a template…
Q: Site-directed mutagenesis of enzyme active site explained
A: Oligonucleotides are generally either DNA or RNA. The length of these is 15-30 nucleotides. The use…
Q: 62 The lagging strand is indicated by c 3' 5' a 9. 5' d 3' C e f a 5' 3' 3' 5' Select an answer and…
A: DNA replication is the process by which new DNA is synthesized from the old DNA molecule by…
Q: What effect does the transposon have on the function of gene X in this figure?
A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…
Q: What would you expect the functional properties of a riboswitch specific for the amino acid lysine…
A: Riboswitch is a gene sequence present on mRNA, which regulates the protein synthesis by binding to a…
Q: Would love a list of different types of nucleotide repeat disorders.
A: Nucleotide is a chemical structure which constitute together to form the genetic structure that is…
Q: 50. Explain the Ribonuclease Experiment and why it was important.
A: Proteins are composed of polypeptides. Polypeptides are polymers of amino acids linked with each…
Q: Select two primers from the list below that would exclusively amplify exon 3 in
A: Polymerase chain reaction was developed by Karry Mullis . It utilizes the ability of DNA to make…
Q: How many RNA primers are need for the leading
A: The act of copying a cell's DNA, or DNA replication, is no easy task. Your genome contains…
Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…
A: Introduction: Mutations are changes in the genetic material or character of an organism. It can…
Q: 32. Why is it necessary to modify the RNA molecule?
A: RNA modification affects the activity, localization as well as stability of RNAs. It occurs in all…
Q: 36. Non-sense mutation results to the formation of a shorter protein than what should be…
A: In a nonsense mutation, or stop mutation, there is a change in DNA sequence that causes a…
Q: hat is the delta variant
A: The Delta variant is presently the foremost distinguished strain of COVID-19, however the Lambda…
Q: Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
A: Sickle cell anemia is the result of a point mutation in the hemoglobin gene. Sickle cell hemoglobin…
Q: Question:- 1. ATT GAC CAA ATC CAT TGA GAC CAA What chains occur when modified DDTP thymine is…
A: ddNTPs result in termination of the DNA strand because ddNTPs lack the 3'-OH group required for…
Transposons in bacterial genomes can carry genes,
including those conferring ________ resistance
Step by step
Solved in 2 steps
- Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________Transposable elements are short segments of DNA, presentin ___________ locations, that move around the genomeMutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
- Tn10 has a ____________ structure and it is composed of a pair of insertion sequence elements (IS10) flanking five genesGene expression is initiated largely in response to changes in the ____________________________ in prokaryotes as opposed to changes affecting the homeostasis of the whole organism in eukaryotes.RNA _________ Causes Gene Inactivation by Destroying the Corresponding mRNA.
- A human oncogene called ras is inserted into mice, creating transgenic animals that develop a variety of tumors. Tumors develop in the mice because ____________________.A _____________________ is a multienzyme complex thatsynthesizes RNA primers during E. coli DNA replication.New mutations are removed from the population by means of __________ __________ due to the deleterious consequences of the disease (two words).
- Suppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.. ___________________________ factors are proteins thatregulate or initiate RNA synthesis by binding directly orindirectly to specific DNA sequences called responseelements.27. Once created, new combinations of genes will be acted upon by ________________________________.