Q: Based on the molecular mechanisms of Duchenne muscular dystrophy come up with two different…
A: Muscular dystrophy is a group of genetic disorders that result in progressive muscle weakness and…
Q: You clone the mouse FOXP2 gene into a plasmid vector, at a cloning site in the lacz gene. The…
A: Bacterial transformation involves introducing foreign DNA (in this case, the mouse FOXP2 gene) into…
Q: Water reabsorption in the proximal convoluted tubule is considered obigatory transport because of…
A: The glomerulus is a specialized network of capillaries in the kidney responsible for the initial…
Q: Are males or females are more often affected by sex-linked traits? Explain why.
A: Sex-linked traits are traits that are encoded by genes on the sex chromosomes, which in humans are…
Q: In the experimental conditions described below, how many molecules of dextrose do you have to add to…
A: Osmolarity is a measure of the concentration of solute particles in a solution. It is expressed in…
Q: 1. Immunocompetent cells, their role in the formation of a specific immune response. Patterns and…
A: The ability of the body to fight against infection because of the presence of specific antibodies is…
Q: What are the advantages and limitations of using marine collagen in the field of health such as…
A: Marine collagen is a type of collagen that is derived from the skin, scales and bones of fish and…
Q: Hematology exam
A: Hematology is the study of blood and blood disorders. Those who perform this study are called…
Q: The biotech approach known as ____________ might be used to grow a healthy banana or cassava plant…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Question 2 of 15 Many nutritional deficiency in B vitamins are associated with what symptoms? I.…
A: Vitamin B refers to a group of water-soluble vitamins that play important roles in various cellular…
Q: Question 11. During ligation, the plasmid vector is prevented from re-ligating to itself by: a.…
A: Ligation is the process of joining two or more DNA fragments together using a ligase enzyme. In…
Q: 8. Which is the correct description of the human chromosome number? * O2n =23 (where n=23, the…
A: Chromosomes are long, thread-like structures made of DNA and protein molecules that carry genetic…
Q: What factors affect the generation time of an organism?
A: Generation time refers to the time it takes for a population of organisms to double in size. It is a…
Q: For this assignment you will be building a concept map of a specific biome’s characteristics and the…
A: A biome is a large biological community or ecosystem that contains a variety of living things, such…
Q: The answer here is incorrect. Can you rework it?
A: When the amount of stored fats in the body increases, it can affect the expression of various…
Q: sterone and estrogen H
A: A form of regulatory mechanism known as a negative feedback mechanism is one in which the output of…
Q: Which of the following is not a function of the smooth endoplasmic reticulum? Group of answer…
A: In eukaryotic cells, the endoplasmic reticulum is a type of organelle which forms a network of…
Q: A pea plant heterozygous for both green pod(G,g)and tall plants(T,t)is allowed to self-fertilize. Of…
A: The term "allele" refers to an alternative form of a gene that decides the expression of a specific…
Q: discuss problem associated with the rabies vaccine
A: A dangerous condition called rabies nearly often ends in death. The brain and spinal cord is…
Q: Analyze and describe the indicated plate characteristics of the special plate for your assigned…
A: Based on the information given in the question, the assigned organism is Escherichia coli or E.coli,…
Q: For the template DNA below, which includes one labeled end of the template DNA, clearly label the…
A: DNA replication is a fundamental process in which a cell's genetic material is duplicated, ensuring…
Q: Centromere A B JI HGF ED C,KLM Inverted region What would be the products if a crossover occurred…
A: Crossing over is an event in cell division where two parental chromosomes come close and lead to the…
Q: Which of the following does NOT contribute to the facilitatory effect of peripheral NE on…
A: Nuclear receptors are a type of intracellular receptor that are typically found in the nucleus of…
Q: 5. Describe the structure of the HIV virion. Explain the replicative cycle and epidemiology of HIV.
A: The infectious component of the HIV virus, also known as the human immunodeficiency virus virion, is…
Q: A population of Giant armadillo, an endangered species found in South America, increased in numbers…
A: Per capita growth rate refers to the rate at which a population grows or changes on a per capita or…
Q: Tree Rendering results 1 1 0.1 Figure 1: Phylogenetic tree. 1 0.97 0.89 0.93 0.94 0.93 073 HIV1_ELI…
A: A phylogenetic tree is a diagrammatic representation of the evolutionary relationship between…
Q: The greater sage grouse is a bird that lives on the Canadian prairies and is considered to be a…
A: The following is the full calculation for yearly per capita growth rate: CGR=((G / N) ) / t Here,…
Q: The fluid in the glomerular capsule is similar to plasma except that it doesn't contain a…
A: ANSWER) Glomerular capsule is the pouch which contains the glomerulus along with the capillaries. It…
Q: Please provide detailed information on this topic: Marine collagen scaffolds in tissue engineering
A: Tissue engineering is a rapidly growing field that aims to create functional tissues or organs for…
Q: Transcribe and translate the DNA strand Remember to use the start and stop sequences.…
A: Transcription is the process by which the genetic information is copied on a messenger that carries…
Q: What can influence lag phase? What are the 2 differing explanations for cell loss in the death or…
A: Bacteria divide by binary fission where one parental cell divides to produce two daughter cells with…
Q: Does glucose concentration affect levels of pH during cellular respiration or no
A: The pH scale is a logarithmic scale based on the concentration of hydrogen ions. The higher the H+…
Q: Homozygous purple flowers have the genotype WW, and W is a dominant allele. A pea plant with unknown…
A: A test cross is a type of back cross in which cross is made between F1 plants and recessive parent.…
Q: Question 12. After transformation by electroporation, you can select transformed bacteria that carry…
A: When a plasmid is successfully transformed into bacteria, the transformed bacteria will have the…
Q: how can targetting L-type calcium channels imporve hypermotility and hypomotilty
A: L-type calcium channels are voltage-dependent calcium channels found in various tissues throughout…
Q: Build a concept map of a specific biome’s characteristics and the major adaptations that are found…
A: A biome is a biogeographical unit that consists of a biological community that can just stop…
Q: 1.What happens during anaphase in mitosis, meiosis I, and meiosis II? What happens if the steps you…
A: Cell division is the process by which a parent cell divides into two or more daughter cells each…
Q: Give typing answer with explanation and conclusion Is an assessment of the effects of chemical…
A: Understanding the potential risks posed by chemical mixtures is vital for safeguarding public health…
Q: A MAN HAS BLOOD TYPE A. HIS MOTHER HAD TYPE O. HIS WIFE HAS BLOOD TYPE B AND HER FATHER HAD BLOOD…
A: On the basis of antigen A and B present on the RBC of our blood, four types of blood groups are…
Q: What are the 3 types of active transport? Be able to diagram each process. What is required for each…
A: The three types of active transport in biology are: Protein pumps: Protein pumps are transmembrane…
Q: How do invasive species impact local ecosystems, and what can be done to control their spread and…
A: Invasive species are non-native species that are introduced to an ecosystem where they can thrive…
Q: Where will the proteins synthesize at the cytosol of a cell and the endoplasmic reticulum or mRNA?
A: Protein synthesis is the process by which cells build proteins using the genetic information encoded…
Q: Describe the differences between an incompletely dominant trait and a codominant trait.
A: Codominant and incompletely dominant characteristics are a few instances of patterns of inheritance…
Q: Importantly, did you find any food sources which would contain more than one of these micronutrients
A: Answer : food sources which would contain more than one of the micronutrients are various types of…
Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…
A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…
Q: Which of the following is NOT a threat to crop diversity? The Cartagena Protocol…
A: Note: According to bartleby guidelines only first question is to be answered. So please upload…
Q: a) What are the important parameters for the eluent selection in Gel Permeation Chromotography…
A: Chromatography is a technique used for the separation, identification, and purification of…
Q: If I am making 500ml of a solution with 0.625ml ITS, 0.0035ml Linoleic acid, 20ml Nu-serum, 0.75g…
A: A homogeneous mixture of two or more substances is referred to as a solution in chemistry when the…
Q: Which of the following is a sign of diabetic ketoacidosis? Select one: A. Dysuria B. Diabetic foot…
A: Diabetic ketoacidosis (DKA) is a serious and potentially life-threatening complication of diabetes…
Questions attached
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- QUESTION 5 Based on the plasmid shown, what will you have to use to to distinguish and isolate the bacteria that successfully took up the plasmid? O Lactose O Tetracycline O Ampicillin O UV light to identify the glowing colonies O XgalQuestion 13 If a recombinant plasmid (below) was obtained inserting DNA into the BamHI site, screening for the recombinant plasmid can be done by which of the following technique? A) Plate on agar plates containing tetracycline and ampicillin. (B) Plate on agar plates containing ampicillin, C) Plate the cells on agar containing ampicillin then surviving colonies are plated on another agar plates with tetracycline. D) Plate on agar plates containing tetracycline. Pal Pord- ampr EcoRI ПРИ Ano pBR322 (4363 bases) Prull BamHI Sall let" Aval -SallQuestion 6 Plasmids that generate blunt ends after restriction enzyme digestion are the ones most effective for recombinant DNA technology. A True B) False
- QUESTION 3 You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1 unit/ul) and water. You want to digest 1.5 ug of plasmid DNA with 1 unit (U) of enzyme in 1X buffer in a total volume of 80 ul. Complete the table below: Solution Stock solution Working solution Volume needed restriction digestion buffer 10X 1X DNA 200 ng/ul 1.5 με enzymes 1 unit/ul 1 unit Water Total 80 μLQuestion 2 A method used to insert or transform cells with a plasmid is to: A add the DNA to bacterial cells that have been lightly treated with lysozyme to produce "holes" in the cell wall. B treat the bacteria with Ca²+, add the DNA, and briefly heat to 42°C. Cadd the DNA to a heated suspension of cells at 42°C. D) mixing plasmids with an extract of broken cells.Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…
- QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…Question 5: Try cutting Plasmid 1 with Xhol. Xbal. Kpnl, and Pstl. Try cutting with all 4 together." Would these enzymes be helpful and informative for creating a restriction map?-Why, or Why not?Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3' ? b) Assuming that the % GC is = 60%. O (2/10)4 (3/10)² O (3/10)4 (2/10)² O (1/6)4 O (1/4)6 O (6/10)4 (4/10)2
- Question 7 Referring to the plasmid below, if a recombinant plasmid were obtained by inserting DNA into the EcoRv site, and the protein corresponding to the recombinant gene were expressed, which of the following statements would be false? Aval Sall A The plasmid will be resistant to tetracycline. B) The protein is not likely to be biologically active without some further treatment. C) The plasmid will be resistant to ampicillin. (D) The plasmid will not be able to replicate autonomously. Pul- Poul- ampr III EcoRI EcoRV BamHI pBR322 (4363 bases) -Poudl lettQuestion 92 True or False? A conjugative R plasmid permits a living bacterial donor to transfer antibiotic resistance genes and genes for conjugation to a recipient bacterium. O True O FalseQuestion 2. You have a wild-type strain of E. coli with the genotype A B C D EF You introduce an F+ plasmid into your wild-type strain and isolated a few Hfr derivative strains that you call Hfr1, Hfr2, and Hfr3. You are studying several new genes in E. coli with interesting phenotypes. You obtain a multiply mutant strain with chromosomal genotype: a b c d e f a) You mate each Hfr strain to your multiply-mutant strain in a separate experiment. At various times you interrupt the matings and plate the bacteria under conditions in which only the recipient strain can grow. You obtain the following earliest-time-of-entry data, in minutes: Gene Hfr1 Hfr2 Hfr3 A B C D E F 11 13 7 I 26 16 11 9 5 31 15 27 31 11 Draw a map of these genes that is consistent with the data, including all the genes and Hfr origins, the distances between them (in minutes), and the direction of transfer of each Hfr.