Transcription Know the central dogma Where transcription takes place What proteins are used for Know how to make a complementary MRNA strand from DNA Enzymes: RNA polymerase Vocabulary: promoter The steps of transcription (initiation, elongation, and termination) What is the outcome of transcription? Translation Where translation takes place Vocabulary: MRNA, TRNA, polypeptide, amino acid, codon, ribosomes Know the start and stop codons Be able to go from DNA->MRNA->codons->anticodons->amino acids Know the tools for translation The steps for translation What are the steps of protein synthesis?

Transcription Know the central dogma Where transcription takes place What proteins are used for Know how to make a complementary MRNA strand from DNA Enzymes: RNA polymerase Vocabulary: promoter The steps of transcription (initiation, elongation, and termination) What is the outcome of transcription? Translation Where translation takes place Vocabulary: MRNA, TRNA, polypeptide, amino acid, codon, ribosomes Know the start and stop codons Be able to go from DNA->MRNA->codons->anticodons->amino acids Know the tools for translation The steps for translation What are the steps of protein synthesis?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 18RQ: A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell...

See similar textbooks

Similar questions

Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
DNA MANNMANN B) mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature mRNA b mRNA Cell membrane You are trying to explain to your classmate how DNA is used to make proteins. What should you include explanation? Select ALL that apply. During translation, the genetic code in mRNA is read and used to put amino acids in place to make a protein. During transcription, the genetic code in mRNA is read and used to put nucleotides in place to make a protein.
RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||
Arrange the processes involved from Transcription to Translation. 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter regions Elongation of RNA transcript Polypeptide cleavage DNA rejoins Partial unwinding of DNA Attachment of the mRNA to ribosome with AUG in the P site Binding of Rho factor Appearance of UAG codon Covalent bonding of AA to the tRNA Release of methionine and conversion to active protein
Iove aIung the HRNA from codon to codon, the appropriate amino acids are brought into place and linked together according to the sequence of codons. Thus, the code in the mRNA is translated into a special sequence of amino acids. The order of the amino acids in the protein, therefore, is specified by the MRNA, which in turn is transcribed from the DNA. Procedures and Observations: During transcription, the DNA double helix unwinds and "unzips. The two strands separate as the hydrogen bonds binding the nitrogen bases break. Then, nucleotides present in the cell line up along one strand of the DNA, the order of the nucleotides determined by the order of the nucleotides in the DNA. As the mRNA forms, uracil (U) nucleotides match with adenine (A) nucleotides; cytosine (C) nucleotides match with guanine (G) nucleotides. Note: RNA contains uracil (U) nucleotides where thymine (T) nucleotides would occur in DNA. The nucleotides in the newly formed mRNA are complementary to the nucleotides of…
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
Where does transcription take place? nucleus cytoplasm ribosome mitochondria Why must transcription occur where DNA can be found? because DNA can't leave because ribosomes are in the nucleus because DNA polymerase is found there because helicase unzips the DNA How many nucleotides equal 1 amino acid? 1 3 TRANSCRIBE this DNA sequence: TACGTTACT AUGCAAUGA ATGCAATGA AUGGATUGA TACGTTACT É O O O O O O O O
RNA polymerase O Transcription to produce pre-mRNA O Post- transcriptional modification Nuclear pore complex OExport of mature mRNA into cytoplasm OPost- Ribosome with transfer RNAS translational O Translation of OProtein folding modifications. mature mRNA Look at the image above: 3. Where does transcription specifically take place in the cell? 4. Where does translation specifically take place in the cell?
If the sequence of the coding strand in a transcription unit is writtenas follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write down the sequence of mRNA
The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'