This question is regarding the 6 areas that can be involved in the control of gen expression: Part 1 - Using the image below, indicate where the six major control points for eukaryotic gene expression are on the figure (Letters A - F). Part 2 - Please give a brief description of what is occurring at each point or the specific molecule(s) for letters A - F.

Q: What are the differences and similarities among the three classes of monoallelic gene expression?

A: The phenomenon of the expression of one allele of a gene is called monoallelic expression. The…

Q: Which of these epigenetic changes could lead to reduced transcriptlon gene? Please make sure to…

A: Epigenetics is the study of changes in organisms produced by changes in gene expression rather than…

Q: complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with…

A: PPE stands for a promoter-proximal element which is an additional promoter that contains AT-rich…

Q: Briefly discuss why mutant allele 1 fails to produce functional protein. Note that this mutation has…

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: I believe the answer would be A and D, but I am not sure because the recombinant proteins are…

A: In biochemistry, heterologous proteins are those proteins that are inserted and expressed in a…

Q: Explain how transcription regulators in eukaryotic cells are able to act at a great distance from…

A: DNA is a nucleic acid present in the nucleus of the eukaryotic cells.

Q: The following question refers to the transcriptional control of the Gal7 locus in Saccramyces…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: For this lac partial diploid mutant in an E. coli strain, indicate whether B-galactosidase and…

A: Lac operon is the segment of DNA which consists of promoter gene, regulatory gene, operator gene and…

Q: Choose the model that correctly shows the regulatory relationships between the nanos, bicoid,…

A: Gene regulation is the process of regulation of expression of a gene. It means to regulate the…

Q: PROTEIN X HAS THE POTENTIAL FOR MEDICAL APPLICATION IN HUMAN. IT IS ORIGINALLY FROM A  PLANT AND HAD…

A: Protein expression is an element of DNA Recombinant innovation or hereditary designing. Protein…

Q: What is meant by the term attenuation? Is it an example of generegulation during transcription or…

A: Attenuation --Definition -- Attenuation is term has different meanings in genetics , microbiology…

Q: All of the following are epigenetic mechanisms that can influence a gene's function EXCEPT? O…

A: The epigenetic control of DNA occurs when the changes in the phenotype occur without a change in the…

Q: MRNA transcripts can be collected from cells, made to glow with a fluorescent dye, and added to a…

A: m RNA separated from hepatocytes will bind to those genes present on the microarrays which has its…

Q: Can I get a paragraph about the Repo protein that is used in Drosophila melangaster?

A: REPO (reverse polarity) is a paired-like homeodomain protein expressed in the glial cells of…

Q: For this lac partial diploid mutant in an E. coli strain, indicate whether B-galactosidase and…

A: Lac operon is the segment of DNA which includes regulatory gene, structural gene, promoter gene and…

Q: You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter…

A: Binding of RNA polymerase II  and transcription factors is necessary for transcription.

Q: If you wanted to make a mouse model for any of the following human genetic conditions (a–d),…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: Given a mutation in the promoter, coding region, and/or non-coding region of a gene, explain how…

A: The mutation is a sudden heritable change in the genetic makeup of a cell which mostly results in…

Q: Phenotypes can be controlled by many processes besides the actual genotype present.  Explain one…

A: Epigenetics is the study of heritable phenotype changes that do not involve alterations in the DNA…

Q: A gene encodes a protein with the following amino acid sequence: Met-Trp-His-Arg-Ala-Ser-Phe A…

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…

Q: please identify structure information about this gene which is adgrg1/gpr56. You can identify…

A: Introduction :- Adgrg1 /Gpr56 (Adhesion G-protein coupled receptor G1 ) as its name indicates that…

Q: The GAL4 expression system can be used to experimentally induce expression of a gene in a specific…

A: INDUCED EXPRESSION - Inducible expression systems are essential molecular tools for the production…

Q: (select all correct answers) Each transposon must have Select one or more: O a. two inverted repeats…

A: A transposable element (TE, transposon, or jumping gene) is a DNA sequence that can move around…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

A:

Q: These are written as either accurate or contain errors. Rewrite each one with an error as an…

A: RNA polymerase is an enzyme responsible for the copying a DNA sequence into RNA sequence. That means…

Q: A gene, which we will call gene C, can be epigenetically modified in such a way that its expression…

A: Introduction: Gene is the structural and functional unit of inheritance or heredity which transfers…

Q: What analogies can you draw between transcriptionaltrans-acting factors that activate gene…

A: Introduction Bacteria are common, largely free-living organisms that are often made up of only one…

Q: Name four control points of regulation of eukaryotic gene expression, and where they occur in the…

A: The four control points of regulation of eukaryotic gene expression are – Epigenetics Transcription…

Q: Please study the diagram above on eukaryotic gene expression. In order to provide instructions for…

A: EXPLANATION : Noncoding DNA is also found within most of the eukaryotic genes. Such genes have a…

Q: From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to…

A: Regulatory proteins are any protein that affects the sections of a DNA molecule that RNA polymerase…

Q: Duchenne Muscular Dystrophy (DMD) is a disease that manifests in muscle weakness. It exhibits…

A: The mutation is the change in the nucleotide sequence that codes for the phenotype in an organism.…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Q: PROTEIN X HAS THE POTENTIAL FOR MEDICAL APPLICATION IN HUMAN. IT IS ORIGINALLY FROM A  PLANT AND HAD…

A: Genetic engineering is the process of making manipulation in genes and DNA  to get desired traits…

Q: In Figure 6-1,a. what do the yellow stars represent?b. explain in your own words why the…

A: Each gene has two copies, also known as alleles, where each allele contributes 50% to the protein…

Q: The human PAH gene encodes the enzyme phenylalanine hydroxylase. Deficiency of this enzyme activity…

A: Genetic disease is caused due to mutation in the gene that may result in malfunction of the gene…

Q: You are studying the regulation of a bacterial gene (TolU) that encodes an enzyme that is necessary…

A: First, let's start with a definition. Promoter: It is the sequence of DNA that is required to turn…

Q: Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for…

A: Albinism is a group of inherited disorders which can lead to no production of melanin pigment due to…

Q: Identify the DNA elements and protein factors, #1- 7, in the figure below that are involved in the…

A: Central Dogma =  According to the central DNA is converted to RNA (transcription) and RNA to protein…

Q: You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate…

A:

Q: Discuss in your own wordings the concept of gene expression. proper explanation and diagram

A: The genetic material present in the nucleus stores the genetic information that is expressed in the…

Q: A full-length eukaryotic gene is inserted into a bacterial chromosome.  The gene contains a complete…

A: There are problems arise when  a eukaryotic protein is expressed in prokaryotic system. A…

Q: Discuss the morphological differences between the parasegments and segments of Drosophila. Discuss…

A: The developmental genes play an important role in guiding the development to find out what kind of…

Q: Why does the controlling expression in eukaryotes require additional levels of complexity?

A: Each physical cell in the body for the most part contains a similar DNA. A couple of exemptions…

Q: Which of these epigenetic changes could lead to reduced transcription of a particular gene? Please…

A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…

Q: Huntington disease

A: Huntington’s disease (HD) is a genetic autosomal dominant neurodegenerative disease caused by the…

Q: Why are some genes expressed and some not? Please be as detailed as possible.

A: Genes are a set of nucleotides sequence that carries information to be passed on from one generation…

Q: The transcription factor that recognizes the TATA box sequence Group of answer choices a.TFIID…

A: Transcription factors are the proteins that bind to a specific DNA sequence. These are the proteins…

Q: Indicate whether the following sentences is either True or False and CORRECT the wrong sentences (…

A: Since you have posted multiple questions we solve the first question for you. To get the remaining…

Q: In a mutant mouse, it was discovered that a gene "W" is moved from its original chromosomal locus to…

A: Answer- Option C -reduced in the mutant mouse than in the wild-type mouse.

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.