There are several levels that describe biological organization. Tell me what these levels are and how they connect to each other and how they are important for a life system.
Q: In Brinjal eggplants, purple fruit is incompletely dominant to white fruit, with the heterozygote…
A: When a white flowering plant is about to make a cross with a purple flowering plant, the resultant…
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A:
Q: Granulocytes and monocyte Platelets Myeloid stem cell Lymphocytes and NK cell Hemocytoblast Lymphoid…
A: Hematopoiesis The process of formation of blood cells is described as hematopoiesis. It begins in…
Q: The respiratory system is capable of absorbing oxygen and excreting carbon dioxide. The digestiv…
A:
Q: A heterozygous individual is crossed with a homozygous recessive individual. a. Draw a Punnett…
A: Punnett square of cross between heterozygous individual and homozygous recessive individual.
Q: Using proteins as fuel requires removing which functional group before the remainder of the monomer…
A: Protein deficiency, also known as "hypoproteinemia", is characterized by low amounts of protein in…
Q: Which of the following lipoproteins is primarily involved in the transport of exogenous lipids O…
A: VLDL and HDL are involved in the transport of exogenous lipids
Q: 39. A 24-year-old primigravid woman at 37 weeks' gestation is admitted because of ruptured membranes…
A: Answer.. Ultrasonography to assess amniotic fluid volume.
Q: USING THE RAINFOREST get data for the following. Dominant plant and animal species Keystone…
A: Location and species found in rainforest.
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: How do abiotic factors affect species distribution?
A: Biotic factors: Living components of ecosystem. These basically falls under 3 catagories:…
Q: auditory nerve
A: Auditory nerves and the brain Nerve impulses are transmitted from the ear to the brain via the…
Q: When would a population grow in an exponential manner? If limiting factors are not present If it…
A: population grow in exponential manner until it reaches the carrying capacity.
Q: Enumerate the different types of phyllotaxy.
A: Phyllotaxy The arrangement of leaves on the stem is called phyllotaxy. It is following three…
Q: Which is INCORRECT about sea urchins? A. Spines are movable B. Secondary spine is shorter a d solid…
A: Sea Urchins are echinoderms having a spiny outer structure. They move with the help of tube feet…
Q: In which of the following phases does this specific arrangement of chromosomes occur? No answer O…
A: 25) The given arrangements of the chromosome shows the stage in which the genetic material of the…
Q: Lipid absorption involves hydrolysis of dietary fat in the lumen of the intestine followed by the…
A: Lipids are synthesised by the smooth endoplasmic reticulum. For absorption of dietary fats, lipids…
Q: This picture shows where the bonds are broken during fat digestion, when it breaks a lipid into…
A: Fats or lipids are the organic compounds which are nearly insoluble in water.They play very…
Q: Chemical Defenses: What is the benefit of having an inducible chemical defense, as opposed to a…
A: ANSWER- d is correct Explain;- In the case of the constitutive chemical defense, the constant…
Q: The following statements are the events that occur during Mitosis. Which of the following is the…
A: Mitosis is the process by which a cell replicates its chromosomes and then segregates them,…
Q: Which of the ff. has a repugnatorial gland and coils into a ball when disturbed? A. Diplopod B.…
A: Various species under the arthropoda phylum are classified under Myriapoda. These possess multiple…
Q: Question 6. Aside from differences in toxicity, what is another possible explanation for the…
A: Answer :- Once deployed uniformly in the field, genetically controlled plant resistance is often…
Q: What are the six functions of the plasma membrane?
A: A biological membranes which serves as a barrier between a cell's outside and inner surfaces is the…
Q: Which of the following describes the role typical proto-oncogenes have when they are expressed in…
A: Proto-oncogenes, although usually associated with tumors do have a very significant role to play in…
Q: Which group of echinoderms has a biradial symmetry and tube feet all over its body?
A: Tube feet is one of the small flexible tubular processes which present in most of the echinoderms…
Q: What is Generation X?
A: Definition: -Generation X is defined as a collective term used to refer to all the Americans born in…
Q: Calculate the driving force for Na+, K+, and Ca2+ current in a neuron under physiological…
A: Driving force refers to the difference between the actual membrane potential and an ion's…
Q: DNA nucleotides are joined together by blank bonds between the sugar and phosphate groups to make a…
A: DNA is a polymer of nucleotides and is composed of two polynucleotide chains.
Q: Food Web Construction Directions: Construct a food web using the following organisms…
A:
Q: A phenylgalactoside-type compound, which yields galactose when enzymatically cleaved, was added as…
A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all…
Q: Imagine the white flowers are recessive to purple flowers, and yellow seeds are recessive to green…
A: A mating between two animals that are perfectly hybrid for two features is referred to as a dihybrid…
Q: You have E. coli growing in HIGH lactose and HIGH glucose. You measure the amounts of protein and…
A: The E.coli is growing in a medium rich in lactose and Glucose both. There are two regulatory…
Q: Which of the following statements are correct? P. Plasma membrane is highly impermeable to all…
A: The plasma membrane is a lipid bilayer membrane which surrounds the cells. The membrane is…
Q: Match the description on the left with the correct term on the right. Some answers may not be used.…
A: Match the correct term on the right to the correct description on the left.
Q: 5. When used for imaging, the wavelength of the radiation needs to be smaller than the thing being…
A: There are diverse types of bacteria,viruses,protozoa and other microbes exist in our…
Q: Differentiate the types of venation.
A: Venation is the arrangement of veins in a leaf or in an insect's wing. This type of arrangement is…
Q: nd reproductive s
A: 1 -Human fertilization and development. 2 Parthenogenesis. 3 Parthenogenesis in animals means the…
Q: a mutant screen in Drosophila, you identified a gene related to memory, as evidenced by the…
A: Recombination is a crucial term in biology. It is necessary for the creation of gene variants. The…
Q: What Gram-negative bacterium might you come into contact with in a unsanitary hot tub?
A: The gram-positive bacteria retain the crystal violet colour and stain purple whereas the…
Q: a. What kind(s) of heritable trait could Pedigree B be? b. What kind(s) of heritable trait could…
A: Pedigree Analysis The pedigree shows the history of a given trait in the family to analyse its…
Q: Briefly describe two of the tree functions of RNA polymerase
A: RNA polymerase is an enzyme that is responsible for copying a DNA sequence into an RNA sequence,…
Q: What determines the maximum rate of Action Potential firing?
A: An action potential is a short-lived event where the electrical membrane potential of a cell rapidly…
Q: Explain how mismatch repair fixes incorrectly matched base pairs.
A: During DNA synthesis, most DNA polymerases use a process is called proofreading to double-check…
Q: What happens to an organism (plant, animal, or microorganism) during genetic modification? A. Fewer…
A: Genetic engineering is a part of recombinant technology in which the gene is altered. A gene is a…
Q: Examine carefully the given plane DNA model below and fill out the required information by…
A: Self replicating biomolecules that are present in the chromosome and carry genetic information are…
Q: What role do hydrogen ion play in the generation of ATP
A: The electron transport chain is a set of four protein complexes that link redox processes to create…
Q: Biology 1. Which statement(s) is/are most correct concerning the history of epidemiology: a. The…
A: Epidemiology The study and analysis of the occurrence, trends, and causes of health and disease…
Q: Predict the effect on the activity of the lac operon of a mutation that disrupts the function of: a)…
A: The Catabolic Activator Protein (CAP) is a protein which acts as a positive regulating factor for…
Q: Which of the field biology tools would be preferred for the species-area curves in a forest…
A: Species area curves in forest ecosystems.
Q: 1. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: Unsaturated fatty acids undergo -oxidation in the same way as saturated fatty acids do until the…
Step by step
Solved in 2 steps
- Explain and describe clearly what a life system is, and how it is important to you and all of us. Also Below, list not less that fifteen (15) life systems and indicate their functions.The Study of Life discusses themes in biology, how life is organized, the types of cellular life forms, evolution, and the process of scientific thinking. In this post, you will demonstrate an understanding of you've learned about the themes in biology, how life is organized, the types of cellular life forms, evolution, and the process of scientific thinking. Choose one concept and describe your understanding of the concept, add information to that concept and lastly pose a question to the class so that they can get involved.The smallest independently functioning unit of an organism is a(n)
- From the biological standpoint, a. What is a LIVING SYSTEM? What are its components? b. How can a living system be sustained?What are the ten levels of biological organization from molecules to the biosphere? (HINT: students should understand Figure 1.3) What are emergent properties? What are reductionism and systems biology? What is the basic unit of structure and function in living systems? What are the two main forms of cells? (HINT: students should know prokaryotic and eukaryotic cells and two characteristics of each.) [Theme 1: new properties emerge at successive levels of biological organization]This activity will help you remember the functions of select cellular structures. Choose 5 or more cellular structures and write an analogy about how those structures function together in an everyday system. The analogous system should be something you already know (e.g., football organization, factory, etc.). Be sure to use only one every day system that incorporates all 5+ cellular structures (and not a different, unrelated system for each structure). Be sure to: Include 5 or more cellular structures Relating all the cellular structures to a single everyday system Accurately representing the analogous functions of the cellular structures Be creative and unique
- Life can be studied and arranged in a hierarchy. Smaller units are building blocks for larger units. Order the biological building blocks from smallest to largest. organism tissue organ organ system molecule atom cellWhat are two examples of a biological system ? They would need to be on different levels, such as molecular, cellular, or organism. Thank you!You can choose one or more than one option: The cytosol: is a static liquid inside the nucleus contains RNA supports the cell and determines its shape contains water as the major quantitative component chemically modifies proteins and other molecules
- What are the different levels of organization in living organisms, from cells to ecosystems?Greetings and thank you for your help Consider the levels of organization of the biological world, and place each of these items in order from smallest level of organization to most encompassing: skin cell, elephant, water molecule,planet Earth, tropical rainforest, hydrogen atom, wolf pack, liverIn your body, you have systems (digestive system, circulatory system, etc.). Each system is made up of organs. Each organ is made up of tissues. Each tissue is made up of cells. Each cell is made up of chemicals. What characteristic of life is being demonstrated by all this?
