The "yoked control" experiments performed during operant conditioning of the aerial respiratory behavior of the pond snail are performed to control for: A. the lack of oxygen in the beaker B. any animals that crawl out of the beaker C. any detrimental effects that the poke to the pneumostome may have on behavior O D. any animals that are not clever enough to learn the association O E. all of the above
Q: vectors. Examine Figure 2 below. Provide three (3) qualitative descriptions of the P. falciparum…
A: Plasmodium falciparum is the causal agent of malaria in humans. It is transmitted to humans by the…
Q: How do animals respond to environmental stimuli? How do plants respond to environmental stimuli?
A: Stimulus is basically noticeable / observable changes takes place inside the body of organism . The…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: anaerobic fates of pyruvate (conversion to lactate or ethanol) in terms of ATP production?
A:
Q: true or false:  mutations add to genetic variation by producing new alleles.
A: INTRODUCTION The change in our DNA sequence that happens as a consequence of errors in DNA copying…
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…
A: The double standard DNA molecule is produced by the action of DNA volume range and the process…
Q: Please could you explain how lymphocytes (especially B) can maintain receptors on their surfaces? Is…
A: Lymphocytes are a type of white blood cell that plays an important role in the immune system. They…
Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…
A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…
Q: E Which choice best describes the location of the majority of the musculo-skeletal system? A. It is…
A: Introduction Bones, muscles, tendons, ligaments, and soft tissues make up the musculoskeletal…
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: NFKB is a transcription regulator that is activated by cytokines, oxidant-free radicals, ultraviolet…
Q: Which of the following receptors is most implicated in the energy crisis following a concussion?…
A: A concussion is a type of brain injury that can occur after a blow to the head. Concussions can…
Q: A man infected with a viral respiratory infection sneezes and releases tiny droplets containing…
A: INTRODUCTION Virus It is a microscopic infectious agent contain DNA or RNA as their genetic material…
Q: Bat/Hedgehog/??
A: MERS is also called Middle East respiratory syndrome. It is a contagious, sometimes fatal…
Q: A cross between plants having seed character RRY (round, green) and rrYY (wrinkled, yellow) will…
A: A Dihybrid cross is a cross between two individuals with two different traits. These two different…
Q: SSBS are: A single-stranded bodies called Okazaki fragments. B substrates for DNA ligases. ©…
A: The biological information flows through genes. DNA is the main genetic material of most of living…
Q: 1 what is the Kel4tionshi gallstahes ahd Pheumohia?
A: Gallstones are classified as very tiny, hard crystalline masses that are generated improperly in the…
Q: Match the different methods of analysis with the approaches in Glycomics v Study of enzyme…
A: *Proteoglycomics is study of structure and expression and function of proteoglycans an modified…
Q: 1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe…
A: Introduction Flamingos are a type of wading bird in the family Phoenicopteridae, they are very…
Q: escribe extensions of Mendelian Analysis
A: In an over view, Mendel's laws have been extended to include Multiple Alleles Incomplete Dominance…
Q: Q4.7. Why does Na* enter the cell during the action potential? Because the Na* channels are open and…
A: Action potential is a process which happens in many type of cells such as neuron, muscle cell,…
Q: Hedgehog - Cell signaling pathway 1) describe its normal function and mechanism,
A: Answer
Q: Mark has an autosomal recessive condition called sickle cell anemia, a serious blood disorder that…
A: Sickle cell anemia is an autosomal recessive disorder which ne it can only expression if present in…
Q: All of the following are functions of connective tissues, except energy and mineral storage.…
A: Introduction Tissue is a collection of cells with similar structures that work together as a unit.…
Q: Which of the following disaccharide repeats is the most stable towards hydrolysis?…
A: Hydrolytic stability is the resistance of a cured polymer material to reverting to a semisolid or…
Q: Do ostriches bury their head in the sand? 2. Please identify the 3 world records held by the common…
A: Answered 1st 2nd 4th
Q: What is the importance of mitosis for the embryonic development?
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…
Q: What is the nucleolus?
A: The nucleolus which is the region present inside the nucleus of a cell and they plays important role…
Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…
Q: Which of the following is true about HIV/AIDS? Group of answer choices All of these are true about…
A: HIV AIDS is most prevalent in the Africa (South >East) and it is fast spreading in western world.…
Q: Hydrophobic and hydrophilic: how do aquatic insects locomote on the surface of water?
A: Hydrophilic and hydrophobic The word Hydrophilic is a combination of two words i.e. "Hydro" which…
Q: Which of the following regions of a genome would be most likely to be a SINGLE CRE? A. A section of…
A: *Genome comprises all genetic information of an organism consists of nucleotide sequences of DNA.…
Q: 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 1.0 0.9 0.8 A? (aa) p2 (AA) Frequency of heterozygotes is…
A:
Q: Answer questions in the table below about the shape of the hydrogen cyanide (HCN) molecule. How many…
A: The structure of the HCN is linear as the central atom is carbon .
Q: Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various…
A: Pluripotent stem cells are the cells which can be developed into any type of the cell in the body .
Q: Describe the variety of growth forms in sac fungi
A: Introduction Fungi are eukaryotic organisms. They can reproduce sexually as well as asexually by…
Q: Question 23) For these three situations below, describe whether there are changes in humoral,…
A: MC4 receptors reduce the food intake while elevating energy utilization . Action of this receptor…
Q: se trhe imlage to arISwer the Posterior pituitary releases oxytocin Baby suckles Oxytocin stimulates…
A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…
Q: What are the external anatomy of a cat and its function? 2. What are the external anatomy of a…
A: Answer
Q: 10. Modified true or false: Write T if the statement is true; if false, write F, underline the word…
A: Plants are classified as flowering plants and non-flowering plants. Flowering plants are divided…
Q: how does a high complexity habitat influence predator and prey interaction
A: * The relationship between predators and prey is important in structuring ecological communities…
Q: A gobi fish creates a burrow at the bottom of the ocean floor. A species of shrimp soon moves into…
A: This relationship, between Gobi fish and shrimp, is called mutualism, where both the individual are…
Q: What are the immunological implications of 'bare lymphocyte syndrome' /MHC deficiency?
A: Bare lymphocyte syndrome (BLS) is relatively a rare condition. In patients with this syndrome,…
Q: Sensory receptors for the kinesthetic senses are located in the thalamus. embedded in the small…
A: Introduction - Sensory receptors are specialised cells found near neurons or neuron endings that…
Q: In all types of bacteria, there are DNA and RNA. * True O False
A: This is true...
Q: Match the following Prompts An AT-rich region found in eukaryotic promoters is called the box. The…
A: 1. An AT rich region found in the eukaryotic promoters is called the "TATA box". The consensus…
Q: What are the parts of auricularis muscles and their specific functions? Tabulate the origin,…
A: The craniofacial muscles are a set of roughly 20 flat skeletal muscles that lie beneath the skin of…
Q: Darwin based his Theory of Evolution by Natural Selection on series of observations. Which of the…
A: In today's world when a pandemic spreads those who have strong immunity could survive and could be…
Q: 13. Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А…
A: A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm.…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT:
A: A promoter is a region of DNA where RNA polymerase begins to transcribe a gene.
Q: Killiani Fisher Synthesis
A:
Step by step
Solved in 2 steps
- O The toxin causes inappropriate firing of neurons leading to periods of rapid twitching that infected individuals experience as summation leading to tetanus. QUESTION 6 Mammalian lungs are very different in structure compared to amphibian lungs. The lungs of mammals have highly complex branching patterns of airways. The lungs of amphibians are simpler and more sac-like. Over all, the lungs of mammals are capable of much greater rates of gas exchange compared to amphibians. Why is this? O The more complex structure provides more surface area across which gas exchange can occur. O A complex structure means that gases have more contact time with gases compared to a simpler structure. O Mammalian lungs are usually much bigger relative to their bodies compared to amphibian lungs. O The respiratory membranes of mammals are able to diffuse gases across them much faster than amphibians. QUESTION 7 Click Save and Submit to save and submit. Click Save All Answers to save all answers. P Type…In most species of mammals, the O2 affinity of a fetus’s bloodhemoglobin is greater than that of its mother’s blood hemoglobin.However, mammal species are not all the same in the mechanismthat causes the affinities to be different. Specify three distinctmechanisms for the difference in affinity between fetal andmaternal blood hemoglobin. Considering the mechanism of the fetal–maternal difference in O2 affinity, would you say that the evolution of themechanism provides evidence for Jacob’s argument? Explain.Question 4 Review Concept 42.6. Match the term and its description. Each term can only be used once. The process that ventilates the lungs includes the alternate | Choose | inhalation and exhalation of air. This is the mechanism where mammals ventilate their lungs by [Choose ) pulling air into the lungs. This is the volume of air inhaled with each breath. [ Choose )
- Pearcy (1977) grew an evergreen shrub (Atriplex lentiformis) collected from cool coastal (Ventura) and hot desert (Death Valley) habitats at two different temperatures regimes and measured various physiological responses. The relationships between respiration and leaf temperature in the figure suggest which of the following? The shrub has adapted to the two different climates. O The shrub has acclimated to the two different climates. O Both A and B are correct. O None of the above is true.There are advantages and disadvantages to using wateror air as the respiratory medium from which an animal takesin oxygen. Which statement below is false?a. Aquatic animals do not have to worry about keepingtheir respiratory surfaces moist.b. Air has a higher concentration of oxygen than waterand varies mostly with altitude only.c. Air has a constant concentration of 21 percent andwater has a constant concentration of 6 percent.d. For terrestrial animals, air is easier to move overrespiratory surfaces because it is less dense than water.Hello, May I get help on this question very soon please? I do not understand it. Scenario: Chris M is a scientist who studies a species of fish that only lives in some desert lakes at the bottom of Death Valley, California. Death Valley is about 282 feet below sea level. He notices that he feels like he can breathe a little better down there than at his home at sea level. He comes to you, his best friend who is a physiologist, and he asks why? You tell Chris… (see image)
- 1. which is true regarding covid 19 A. if answer 1, 2, 3 are true B. if answer 1, 3 are true c. if answer 2, 4 are true d. if only the answer 4 is true e. if answer 1, 2, 3, 4 are true 2. which of the following is the conducting structure of respiratory system A. if answer 1, 2, 3 are true B. if answer 1, 3 are true c. if answer 2, 4 are true d. if only the answer 4 is true e. if answer 1, 2, 3, 4 are trueQUESTION 2 Briefly describe the mechanism involved to maximize the oxygen-carbon dioxide exchange in a fish.Question 2 If a person suffers a chest wound that allows air from the outside to leak into the pleural cavity, the lung may collapse. A. What holds the lung open normally? B. Why would the lung collapse in this situation?
- Suggest a reason for the observation that people with sickle-cell trait sometimes have breathing problems during highaltitude flights.Help me pleaseQuestion 2 Which part of the airway does smooth muscle play its greatest role in Poiseuille's Law? O A. Trachea B. Bronchioles OC. Primary bronchi D. Alveolar ducts OE. Alveoli