The rate constants of an enzyme-catalyzed reaction, obeying the Michaelis-Menten kinetics, have been determined : K₁ K₁ = 2 x 108 M-¹ K-₁= 1 x 10³ S-1 K₂ = 5 x 10³ S-1 E + S -1 S K-1 ES k₂ E +P 1- Determine the Michaelis constant Km of the enzyme. 2- Determine the catalytic constant (kcat) of the enzyme. 3- Determine the catalytic efficiency of the enzyme.
Q: Determine the amount of glucose in the unknown sample by plotting a standard curve of Absorbance at…
A: Here we are conducting an assay to determine the amount of glucose in an unknown sample. For this,…
Q: Determine how many water molecules are used to completely oxidize Lignocerate (24:0) 8 10 014 011 9…
A: Fatty acids are long chain hydrocarbons with a carboxyl end. Glycogen is the storage form of…
Q: .Here is an oligomeric protein, which has two binding sites: 1)Write the formulas of side chains of…
A: Oligomeric proteins are quaternary structure proteins which possess more than one subunit of…
Q: Calculate the expected activity for each unknown hallucinogen using the QSAR relationship that you…
A: QSAR (Quantitative Structure-Activity Relationship), is a technique used to predict the activity of…
Q: DNA MELTING Two antiparallel single strands form a DNA duplex according to the following model: SA…
A: Gibbs's free energy, also known as free energy or G, is a thermodynamic quantity that represents the…
Q: a. Calculate the physiological DG of the reaction shown below at 37°C, as it occurs in the cytosol…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: ATP is the primary source of cellular energy. What qualities of ATP make it a useful energy…
A: ATP acts as the “energy currency” of the cell. The energy that is released during fuel oxidation in…
Q: Relate sugar fermentation to the biochemical tests in bacterial identification
A: Glucose can be catabolized either aerobically (in the presence of O2), in which molecular oxygen…
Q: Identify different types of organic reaction mechanism (SN1, SN2, etc) and reaction types (addition,…
A: SN1 reactions are substitution nucleophilic reactions that occur in a single step. They involve the…
Q: Consider a hypothetical metabolic pathway involving four enzymes to convert molecule A into molecule…
A: Allosteric enzymes are enzymes whose catalytic activity is regulated by an effector molecule that…
Q: Calculate AG for ATP hydrolysis in muscle at 16 °C. Use the muscle concentrations from the first…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: Soy milk is rich in vegetable protein (about 4.5 grams of protein per 100 grams of soy milk) and…
A: INTRODUCTION : Proteins : Proteins are simple & complex biocompounds which are needed by the…
Q: Which of the following is activated after epinephrine/ glucagon binds to their receptores select all…
A: Glucagon and epinephrine are hormones that increase the blood glucose levels. So all those processes…
Q: 8. [1-¹4C]Glucose Catabolism An actively respiring bacterial culture is briefly incubated with…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: 3 4 Ag₂O NH₂OH, H₂O KMnO H₂O*
A: 3. This is an example of Tollens's reaction. Where Ag2O and NH4OH reacts to form ammonical silver…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: Which statement about glutamine amidotransferases is FALSE?
A: Glutamine amidotransferases is an enzyme which catalyzes the removal of ammonia group from glutamine…
Q: What are the other abundant source of lipids aside from egg yolk. Provide details on how you can be…
A: Lipids are a type of organic molecule that contains fatty acids as their monomers. They are there in…
Q: The aromatic side chain of Trp residues in proteins and peptides can be chemically modified by two…
A: Amino acids are classified as acidic, basic, hydrophobic and polar neutral based on the nature of…
Q: show how you would use bromination followed by amination to synthesize glycine show how you would…
A: Amino acids are building blocks of proteins. Alpha carbon of amino acids consist of carboxyl group,…
Q: Using the tree structures for the following monosaccharides and comparing to that for glucose, draw…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene…
A: Mutations in the following gene gives rise to a genetic disorder known as Xeroderma pigmentosum.…
Q: You are studying an enzyme and wish to determine how an inhibitor functions. The enzyme reaction is…
A: Inhibitors are the substances that bind to enzyme and influence the enzyme activity . There are four…
Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…
A: In the cellular environment, the condition do not allow biochemical reactions to occur at…
Q: The diffusion rate of four different membrane proteins (A, B, C, and D) was measured using a FRAP…
A: FRAP is short for Fluorescence recovery after photobleaching, is a method used for determining the…
Q: (a) Where might bends or 3 turns occur? (b) Where might intrachain disulfide cross-linkages be…
A: Proteins are made up of amino acids that are linked together by peptide bonds. The simple linear…
Q: Hydrogen bonds in water: (one or more may apply) Group of answer choices create surface…
A: Introduction :- The questions are all about the water molecules, their bonding pattern, the bond…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…
A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…
Q: E. coli replication on the lagging strand O is carried out by DNA polymerase I O is initially…
A: In E. coli genetic information is stored in form of DNA. E. coli DNA is circular in shape. DNA…
Q: For the study of alanine production by a recombinant strain of E. coli, cultivation was carried out…
A: A recombinant strain is a type of genetically modified organism (GMO) that has been artificially…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: In a folded protein, Glu116 is close in three-dimensional space to Lys224. The pKa of the carboxylic…
A: pKa is the pH at which a weak acid is 50% dissociated. Alternatively, pKa = -log Ka. In acid-base…
Q: Calculate hematocrit for Susie's whole blood sample, given the following information: RBC volume =…
A: Introduction Whole blood is composed of erythrocytes (RBC), platelets and leukocytes (WBC). The…
Q: How much 6x loading dye should be added to 49 uL of DNA? Report you answer in units of uL, with one…
A: The equation of dilution: M1xV1 = M2xV2 Where, M1 is the molar concentration of the stock solution.…
Q: Metabolic enzymes are often found in large multi-enzyme complexes. What are the benefits of this…
A: Enzymes are biological catalysts that catalyse biochemical reactions. Substrates bind to the free…
Q: Part A. Weight of skimmed milk Isolation of Casein Weight of dried casein Percentage casein in…
A: Since you have posted multiple questions, we will provide the solution only to the specified sub…
Q: Question 1 Signal sequences direct their delivery to different locations in the cell or outside the…
A: The proteins are made of twenty naturally occurring amino acids that are linked via peptide…
Q: Question 22 Each GroEL subunit has an ATP-binding pocket that catalyzes hydrolysis of its bound ATP…
A: GroEL-ES is a molecular chaperone complex assit in folding of cellular proteins. GroEL is composed…
Q: PLEASE HELP How many stereoisomers or ribose are there?
A: Stereoisomers are the isomeric molecular structures with same composition but with different…
Q: Where do the atoms come from to make carbohydrates, lipids (fats), and proteins?
A: INTRODUCTION : Atoms : Atom is the smallest unit of any organism, particle, metal, non metal or any…
Q: Give the molecular and structural formulae for: –2 examples of structural isomers of monosaccharides…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Match the following steps of oxidative phosphorylation in increasing order from beginning (1) to end…
A: Oxidative phosphorylation is the process by which oxidation of NADH and FADH2 by the complexes in…
Q: describe the relationship between a proto-oncogene and an oncogene, and explain how one arises from…
A: Proto oncogenes is a normal gene but when mutated it turns into oncogene and gets the potential to…
Q: The following assays is/are considered a DIRECT ASSAY: A. absorbance B. рн C. Viscosity D. All of…
A: Process of analyzing a substance to determine its composition or quality is an assay. In medicine,…
Q: Identify the steps in the glycolytic and citric acid cycle pathways where ATP, GTP, NADH, and FADH2…
A: Introduction Citric acid cycle is also known as tricarboxylic acid (TCA) cycle. It is an important…
Q: During starvation, the glycerol backbone of triacylglycerols can be used to make glucose. What…
A: Gluconeogenesis is the pathway by which glucose is formed from non-hexose precursors such as…
Q: 6. List four (4) organelle structures that are similar for both plant and animal cells. List the…
A: Cell organelles, or simply Organelles, are subunits present in a cell responsible for carrying out…
Q: c) Explain why the proton Mitchel's proton gradient mechanism is implausible. What is the most…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) is well…
Q: The concentration of protein in a solution can be determined via UV spectroscopy and colorimetry*…
A: UV spectroscopy UV spectroscopy is a technique which uses the absorption of ultraviolet radiation by…
Q: Question 4 An N-linked glycoprotein contains a glycan covalently linked to which specific amino acid…
A: the proteins are constituted of twenty naturally occurring amino acids that are linked vis peptide…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The protein catalase catalyzes the reaction 2H,O,(aq) — 2H,O(l) + O,(g) and has a Michaelis-Menten constant of KM = 25 mM and a turnover number of 4.0 × 107 s¯¹. The total enzyme concentration is 0.010 µM and the initial substrate concentration is 4.83 µM. Catalase has a single active site. Calculate the value of Rmax (often written as Vmax) for this enzyme. Rmax Calculate the initial rate, R (often written as V), of this reaction. R = ×10 mM.s-1 mM-s-1The initial rates of an enzyme-catalyzed reaction have been determined for five different [S] (see table below). [S]o (mol.L-¹) 1.0 x 10 1.5 x 10-4 2.0 x 10-4 -4 5.0 x 10 7.5 x 10-4 -1 Vo (μmol.L-¹ min-¹) 28 35 42 63 75 1- Determine graphically the value of Km (first with the Michaelis-Menten representation and then with the Lineweaver-Burk representation, then compare by reporting on the Michaelis-Menten representation the values found by the Lineweaver-Burk representation) 2- Calculate the concentration of a competitive inhibitor 1, with a K₁ value of 2.4.104 M, whose action would quadruple the apparent value of Km.You are working on an enzyme that obeys standard Michaelis-Menten kinetics. Based on the following reaction expression, what is the Km value for this enzyme? E+SESE + P . . . k₁ = 880.8 M-¹5-1 k.₁ = 42.18 S-1 k₂ = 56.29 S-1
- Assume that an enzyme-catalyzed reaction follows the scheme shown: E + S ES E + P k₁ = 1 x 10%/M-s k-1 = 2.5 x 10%/s k2= 3.4 x 107s What is the dissociation constant for the enzyme-substrate, Ks? What is the Michaelis constant, Km, for this enzyme? What is the turnover number, Kcat, for this enzyme? What is the catalytic efficiency for the enzyme? If the initial Et concentration is 0.25mM, what is Vmax?A particular enzyme-catalyzed reaction has an apparent Vmax = 9.00 nmol s-1 and α' = 3.00 when 2.00 µmol L-1 inhibitor X is present and uncompetitively inhibiting the reaction. Calculate Vmax for the uninhibited reaction in nmol s-1.The KMof the enzyme for the substrate adenosine is 3 × 10ꟷ5M. The product inosine acts as an inhibitor of the reaction, with an inhibition constant (KI, the dissociation constant for enzyme-inhibitor binding) of 3 × 10ꟷ4M. However, a transition state analog,Inhibits the reaction with KIof 1.5 × 10ꟷ13M. Explain why 1,6-dihydroinosine serves as a better inhibitor of adenosine deaminase than inosine. Elaborate on your answe
- Although graphical methods are available for accurate determination of the Vmax and Km of an enzyme-catalyzed reaction, sometimes these quantities can be quickly estimated by inspecting values of V0 at increasing [S]. Estimate the Vmax and Km of the enzyme-catalyzed reaction for which the following data were obtained:41 The following data describe an enzyme-catalyzed reaction (hydrolysis of carbobenzoxyglycyl-L-tryptophan) Plot these results using the Lineweaver-Burk method, and determine values for KM and Vmax Velocity (mM.sec-) 0 024 0 036 0 053 0 060 0 061 0 062 Substrate Concentration (mM) 25 50 10 0 15 0 200 25 0 42 If the KM of an enzyme for its substrate remains constant as the concentration of the inhibitor increases, what can be said about the mode of inhibition and why? 43 Calculate the turnover number for an enzyme, assumıng Vmax IS 05 M sec1 and the concentration of the enzyme used is 0 002 M Why is it useful to know this? 44 Dıscuss the mechanism of the Bohr effect that occurs during the interactions of Hb with oxygen under physiological conditions in the lungs and tissues Make use of relevant graphs and diagrams to explain your answer#1 Specify the role each of the following amino acids play within the crystal structure and/or active site for Be as specific as possible, with pictures (and mechanistic arrows) as necessary. His11 Arg140 Glu89 Trp68 #2 Provide a step-wise mechanism for the reaction Bisphosphoglycerate mutase catalyzes, using the amino acids responsible for aiding in catalysis. You do not need to add surrounding amino acids that aid in substrate specificity. (drawn out)
- Enzyme X can be inhibited by two distinct inhibitors, only one of which is acting as a competitive inhibitor, while the other one is non-competitive. The three plots below (designated A, B, and Cy show Michaelis-Menten kinetics for the reactions carried out with the same concentr ation of the enzyme and either in the absence of any inhibitors or in the presence of one of the two inhibitors. Match the type of reaction (uninhibited, competitive inhibition, non-competitive inhibition) with the corresponding plot? Plot A Plot B Plot C Substrate concentration 1.Plot A v LUninhibited roaction 2. Plot C v Inhibition by a competitive inhibitor 3Plot B v Inhibition by a non-competitive inhibitor A Moving to another question will save this response. lupa) Determine kcat (in units of sec-1) for a particular enzyme, given the following information: Vo = 144 mmol/min; [S] = 2 mM; Km = 0.5 mM; Enzyme Molecular weight = 40,000 mg/mmole; 8 mg of enzyme used in assay generating this data. b) In general, explain how the total enzyme concentration affects turnover number and Vmax?An enzyme has a V of 1.2 uM s The Km for its substrate is 10 µM. max Calculate the initial reaction velocity, Vo, for each substrate concentration, [S]. Calculate Vo when [S] is 2 µM. Vo = µM s Calculate Vo when [S] is 10 µM. Vo = µM s-1 Calculate Vo when [S] is 30 µM. Vo = µM s-1