The nitrogenous bases present in RNA are the same as those present in DNA except that: Adenine replaces cytosine Adenine replaces thymine Uracil replaces adenine uracil replaces thymine cytosine replaces guanine
Q: This data shows the efficacy of different treatments on the survival rates of patients with…
A: The figure mentioned appears to be about the viability of distinctive medications on the survival…
Q: what is the mode of action of abamectin in insects?
A: Abamectin is an insecticide and acaricide derived from the bacterium Streptomyces avermitilis. It…
Q: Dissimilarity in plant community composition between 1982 and 1985 was larger than dissimilarity in…
A: Ecology is the branch of science that deals with the study of relationships between living…
Q: Which of the following is an antioxidant? Vitamin E Glucose Cholesterol Palmitic acid Vicine
A: The objective of the question is to identify which among the given options is an antioxidant.…
Q: 1) Does the three t-tests support the hypothesis: of manipulating light exposure will influence the…
A: Thе t-tеsts conductеd on Brassica rapa plants еxposеd to sunlight and incandеscеnt bulbs aim to…
Q: ach of the components below should be 1 or at most 2 sentences. Abstracts are 1 paragraph, it is…
A: The research hypothesis revolves around examining the influence of light exposure duration on the…
Q: 3. Fill in this summary table to compare and contrast types of transport. For secondary, first you…
A: All living cells must receive nutrition, water, electrolytes, etc. that must enter the cell. At the…
Q: Carbon-14 is a radioactive material. It contains 6 protons and 8 neutrons. During the process of…
A: The objective of the question is to understand the changes that occur in the atom of Carbon-14…
Q: Which of the following digestive enzymes is incorrectly matched with it's substrate and product?…
A: The question is about coordinating digestive enzymes with their substrates and products. The…
Q: Two genes control the color and texture of tomatoes: Allele "R" generates a red coloration, and is…
A: The objective of this question is to determine the probability of getting a tomato plant with red…
Q: 1 ml Sample Tube dilution Final dilution 1 ml sample 4. Fill in the values below (0.5) Tube dilution…
A: Disclaimer: " According to the bartleby guidelines, only one question is to be answered. Please ask…
Q: > 5 0/1 point Let's continue with these two genes that control the color and texture of tomatoes.…
A: Allele "R" generates a red coloration, and is dominant. Allele "r" generates a green coloration and…
Q: African Elf Pygmies have short stature as a result of the interaction of altered levels of growth…
A: Human growth hormone (hGH or HGH) commonly referred to as somatotropin or growth hormone (GH) is a…
Q: A strain of plants has a mean height of 24 cmcm. A second strain of the same species from a…
A: The objective of the question is to determine the number of gene pairs involved in the height…
Q: 1 point Later on, you made a completely new cross. But you cannot remember the genotype from one of…
A: The objective of this question is to determine the genotype of the unknown parent in a genetic…
Q: Write an essay describe the digestive processes used to extract nutrients from a meal consisting of…
A: The digestive process begins in the mouth, where the food is broken down into smaller pieces by the…
Q: iscuss the mismatch between amino acid patterns in modern humans and the food they typically…
A: Thе modеrn human diеt, charactеrizеd by procеssеd foods and agricultural practicеs, oftеn lеads to a…
Q: You are studying a mouse model of gastrointestinal infections and isolate cells and proteins from a…
A: Antibodies, also known as immunoglobulins, are proteins produced by the immune system to neutralize…
Q: Who determines whether your application for a Therapeutic Use Exemption (TUE), allowing you to use a…
A: The objective of the question is to identify who is responsible for approving or denying a…
Q: erythroblastosis fetalis
A: Erythroblastosis fetalis, alternatively termed hemolytic disease of the newborn (HDN), arises from…
Q: Let's continue with these two genes that control the color and texture of tomatoes. Allele "R"…
A: A dihybrid cross is a breeding test including two parents that contrast in two characteristics, each…
Q: You are tasked with determining the PMI from the following information. If vou are unable to do so…
A: The amount of time that has passed after a person passes away is known as the post-mortem interval…
Q: What is the complementary sequence of the following DNA strand: AATCGTCTAAGGCC
A: The objective of this question is to find the complementary sequence of a given DNA strand. In DNA,…
Q: You cross a purple flower plant (Ww) with a white flower plant (ww). You can assume W is dominant…
A: The objective of the question is to predict the number of white flower plants that can be expected…
Q: Mycophenolate mofetil was administered for 1 month after the intravenous injection of donor cells.…
A: Neutropenia denotes a medical condition characterized by an insufficient quantity of neutrophils, a…
Q: nts cycle through ecosystems through decomposition. The figures show data on the position rates in a…
A: Here the daily rate of mass loss refers to decomposition of the leaves. In the first graph different…
Q: For predators that devour their prey, how does their digestive tract function to digest the food
A: A fascinating feature of the physiology of predators that consume their prey is their intricately…
Q: What is not found in a prokaryotic mRNA transcript? Stop codons AUG codons multiple adenines in the…
A: The question is asking us to identify which of the listed elements is not found in a prokaryotic…
Q: In fruit flies, the red allele is dominant to the allele for sepia eyes. In a certain population of…
A: The square expansion of the allele frequencies represents the relationship between genotype…
Q: The diagrams illustrate the hypothetical amount of biomass and energy available at each trophic…
A: Trophic level is actually position attained by the organism ( represented in steps) in the food…
Q: To what infraclass do pigs belong? --Metatheria --Protheria --Eutheria --Theria --Mammalia
A: The infraclass is a level below subclass and above order. This is also a kind of biological…
Q: Describe the symptoms, pathology, and treatment of Alzheimer’s Disease at the introduction level…
A: A cellular mechanism for learning and memory, long-term potentiation (LTP) is the steady…
Q: List at least 3 impacts that Homo sapiens have had on biodiversity.
A: The question is asking for at least three ways in which Homo sapiens, or modern humans, have…
Q: Ecology Lab Worksheet 8: Species Diversity Habitat 1 Garage Lake N (Total number of individuals in…
A: Habitat 1: Garage Lake NTotal number of individuals in all species (N) = 325Number of species (S) =…
Q: Find the Open reading frame. Then tell me how many codons are in the ORF? Provide a single integer
A: Transcription is a biochemical process of formation of mRNA from DNA. the mRNA sequence so formed is…
Q: Are we still evolving? Explain
A: Yеs, humans arе still еvolving, although thе nature of еvolutionary procеssеs has shiftеd. Unlikе…
Q: consider Smallpox, Polio, Ebola and Measles Label each of the SIR curves below with the correct…
A: Thе SIR (Suscеptiblе-Infеctious-Rеmovеd) curvеs providеd dеpict thе tеmporal dynamics of infеctious…
Q: CRISPR-Cas9 provides an unprecedented means of modifying the genome of almost any organism. Which of…
A: CRISPR-Cas9, which stands for Clustered Regularly Interspaced Short Palindromic Repeats and…
Q: M 0 0 0 0 0 Pro Leu Giv Gly Met Gly Leu lle Factor Gly A Leu € which of the following options is the…
A: In the given question, the sequence of mRNA is AUU, GGC, UUA and UAG.UAG is stop codon that acts as…
Q: 2 3. (6 points) In mice, fur color is controlled by two genes that exhibit complete dominance. Gene…
A: Mice's pigmentation is a complex trait regulated by multiple genes. In mice, eumelanin (black or…
Q: 1. (8 points) This figure summarizes the transport of various substances across biological…
A: The correct matches can be identified as follows-1. Passive transport - A2. Pump protein - G3.…
Q: Use the scheme above to calculate how many moles of ATP is needed for transporting 1 mole of glucose…
A: To calculate the moles of ATP needed for transporting 1 mole of glucose through a human intestinal…
Q: Major difference between prokaryotic cells and eukaryotic cells?
A: The word “pro” means before. prokaryotic means "before nucleus". These cells are the simplest cells.…
Q: Why is stimulating cells with LPS done for Splenocyte Preparation
A: Any form of white blood cell that is found in the spleen or has been isolated from splenic tissue is…
Q: (a) The variant least likely to cause pathological symptoms. Hb Memphis (b) The variant(s) likely to…
A: Hemoglobin is a protein molecule found in red blood cells which transports oxygen (O2) from the…
Q: Correctly match the complementary base pairs in DNA. Adenine Guanine 1. Uracil 2. Cytosine 3.…
A: The objective of the question is to correctly match the complementary base pairs in DNA. In DNA,…
Q: The figure below shows a very simplified interaction of energy flow or a northern hardwood forest…
A: The data provided recommends that invasive earthworms have a critical impact on soil environment and…
Q: C4 plants outgrow C3 plants in hot climates because O They temporally separate the initial carbon…
A: The plant kingdom includes multicellular, photo autotrophic eukaryotes. These organisms have a cell…
Q: 1 point Before we start the actual translation process. If we look at our transcript from sequence…
A: The open reading frame (ORF) in the image is the sequence ATGTTTACCGGGGGGACTGAGGGGAAATATATGTAA. This…
Q: If the other three forces that determine fluid movement were unchanged, an increase in blood…
A: The objective of the question is to understand the effect of an increase in blood hydrostatic…
The nitrogenous bases present in RNA are the same as those present in DNA except that:
Adenine replaces cytosine
Adenine replaces thymine
Uracil replaces adenine
uracil replaces thymine
cytosine replaces guanine
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphateDraw the complete structure of uridine 5′-phosphate, one of the four major ribonucleotides.Snake venom phosphodiesterase hydrolyzes nucleotides from the 3' end of any oligonucleotide and cleaves between the 3' hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. Which nucleotide would be released first from the oligonucleotide shown below upon treatment with snake venom phosphodiesterase? choices a. Deoxythymidine 5'-monophosphate b. Deoxyguanosine 3'-monophosphate c. Deoxyguanosine 5'-monophosphate d. Guanosine 5'-monophosphate e. Deoxythymidine
- Amino Acid SLC DNA codons Isoleucine Leucine Valine Phenylalanine Methionine Cysteine Alanine Glycine Proline Threonine Serine Tyrosine Tryptophan Glutamine Asparagine Histidine Glutamic acid Aspartic acid Lysine Arginine I |АTT, АТC, АТА L |стт, стс, СТА, СТG, ТТА, ТTG V GTT, GTC, GTA, GTG F TTT, TTC M ATG TGT, TGC A GCT, GCC, GCA, GCG G GGT, GGC, GGA, GGG P |сст, ссс, ССА, ССG |АСТ, АСС, АСА, АCG |тст, тсс, ТСА, ТCG, AGT, AGс Y |ТАТ, ТАС W TGG CАА, САG N |ААТ, АAС H САТ, САС E GAA, GAG D GAT, GAC K |AАА, АAG R CGT, CGC, CGA, CGG, AGA, AGG Stop codons Stop |TАА, ТAG, TGA How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note that * represents a stop codon)In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a single tRNA molecule to recognize more than one codon using its one anticodon sequence. It requires a shift in position of the two nucleotides. Guanine and uracil come together in this unusual pair via 2 hydrogen bonds. Based on what you know about hydrogen bond formation and base pairing, draw a guanine nucleotide and a uracil nucleotide hydrogen bound to one another.Draw the structure of the RNA dinucleotide formed between cytidine-5’-monophosphate and adenosine-5’-monophosphate. Your structure should show cytidine with a free 5’ and adenosine with a free 3’.
- Place an asterisks (*) next to the 3' carbon atoms in the polynucleotide shown. -O CH₂ HOHDH Guanine -O-CH₂ H H H Thymine =P-O-CH₂ H OH Answer Bank H H CytosineDNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?When comparing the structures of RNA and DNA , which of the following statement is True?A-Only RNA contains 3'-deoxyribise rings B-Both RNA and DNA contain 3'-deoxyribise rings C-Only DNA contains 3'- deoxyribise rings D-Neither RNA or DNA contain 3'-deoxyribise rings
- Hydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. H₂N HN N O™ -O-P-O-CH₂ Guanine H₂N N HN Select the chemical consequences that could contribute to DNA instability at AP sites. H H 1₂0/ H fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base H H Guanosine residue (in DNA) O™ -O-P-O-CH₂ O H H H O Apurinic residue H OH HDraw the structure and give the name of a nucleotide made of adenine (A) and deoxyribose.Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’