The nervous system is like a communication system because _____. a neurons work in pairs to collect sensory information b the nephrons receive and transmit information c signals travel through neurons as electrical impulses

Q: True or false:  The hydrolysis of ATP is exergonic (spontaneous)  True  False

A: Metabolism is a phenomenon in which energy is either liberated or formed . Metabolism is classified…

Q: Match the mineral to its main function. chloried insulin enhancement sodium, potassium thyroid…

A: Insulin  A hormone that controls the level of glucose in the blood stream.

Q: Why monarch butterflies are supposedly toxic?

A: Due to its size and spectacular orange, black, and white pattern, the Monarch butterfly (Danaus…

Q: Systemic acquired resistance______ . a. occurs in response to pathogen detection b. causes the…

A: Introduction  When compared to susceptible plant varieties under similar climatic conditions and…

Q: The cell cycle contains a series of events that control the division of cells. It is controlled by…

A: Introduction: A cell cycle is a series of events that takes place in a cell as it grows and divides.…

Q: Place the steps regarding fat digestion and absorption in the correct order. The abbreviation TAG is…

A: Introduction Digestion is the process of breakdown down food into smaller particles that can be…

Q: Class Genus Common Name

A: A no. of intestinal nematodes cause diseases affecting the human beings, including : ascariasis,…

Q: 11. Why is cell membrane said to be selectively permeable? * A. because of the polar nature of tail…

A: The plasma membrane which is also known as cell membrane is the membrane found in all the cells that…

Q: How does genetic therapy differ from traditional methods of treating a disease?   a. It targets the…

A: Gene therapy is the modern approach to treat a disease from the root of its occuarance. Traditional…

Q: please help me understand more by answering the same questions but with 16 carbons

A: In one pass through the fatty acid oxidation sequence one molecule of acetyl co enzyme a, 2 pairs of…

Q: Do you believe that chimpanzees should be classified in the same family and/or subfamily as humans?…

A: Chimpanzees and humans are almost identical. The difference between two humans would more or less be…

Q: hat kind of information That is the application is derived from polyphasic taxonomy? of polyamines…

A: Taxonomy can be defined as the process of classification on the basis of organisms characteristics.…

Q: 3 00 kl c. nondisjunction d. meiosis I O e. meiosis II enetically male 8-week-old fetus that…

A: In 1st diagram pairing of homologous chromosomes takes place. Chromosome number is 4 In 2nd…

Q: Fats, cholesterol and waxes are examples of which type of biomolecules? * A. Carbohydrates B.…

A: Biomolecules are chemical compounds found in living organisms. These include carbohydrates, lipids,…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: where did the GTP come from?

A: Introduction  Beta-oxidation is a catabolic process in which fatty acid molecules are broken down in…

Q: Compare the ratio of white:black moths in the first generation to much later generations in the…

A: Natural selection can alter the frequency distribution of  alleles and the heritable traits in…

Q: Life can be studied and arranged in a hierarchy. Smaller units are building blocks for larger units.…

A: Unicellular organisms are made up of single cells. Multicellular organisms are made up of more than…

Q: Answer the following about low carbohydrate diets: true/false Is made up of a large about of nonfat…

A: 1) A low carbohydrate diet is the one which includes the food items that contains a low amount of…

Q: Due to their symbiotic relationship with algae coral is an example of what?

A: Introduction:   Corals and algae are symbiotic partners. The coral creates a safe place for algae…

Q: Which lipid type is not an important structural component of the cell membrane structure?  a.…

A: The thin, living, elastic, semipermeable lipoproteinaceous membrane that is present around the cell…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: In our Desire primer it  is 15 nucleotide long however on gels there are only 10 bands are present…

Q: An important difference between plant development and animal development is that______ . a. only…

A: Introduction: Plant growth can be described as the increase in volume and/or mass of a plant, with…

Q: Create a flow diagram for this cardiovascular system that has these elements in correct order • Vena…

A: Introduction  The circulatory system (cardiovascular system) transports oxygen-rich blood from the…

Q: which subunits make up an amino acid molecule

A: The amino acids are the building blocks of proteins. Amino acids are joined together by peptide…

Q: The evolution of influenza virus that causes relatively mild and limited disease epidemics is…

A: The influenza virus is a negative-sense single-stranded RNA that causes severe infection to the…

Q: ITEM MSM MICROBIAL PROFILE MICROORGANISM/CAUSATIVE I AGENT A GRAM REACTION B OXYGEN REQUIREMENT C…

A:

Q: compensation in genetics

A: Genetics is a branch of biology. In this branch  we can discuss about the   genes, genetic…

Q: How is our concept of human form and function today affected by inventors from the seventeenth to…

A: Introduction :- Humans are the most numerous and ubiquitous primate species, distinguished by…

Q: Water molecules 00 (a) (b) (c) Solute molecules

A: osmosis is the net movement of water across a semipermeable membrane from an area of lower solute…

Q: Give an example of a concrete situation, in the human body, which would lead to DNA replication and…

A: DNA replication refers to the production of more copies of DNA using the available DNA as a…

Q: Draw phylogenetic tree of the given newick format :((A,B,(C,D)),(E,F))

A: The connection between trees and stacked parentheses, discovered in 1857 by the famed English…

Q: Based on the results of Mendel’s experiments, what principle of heredity supports his findings on…

A: Introduction  The transmission of qualities from parents to offspring is referred to as heredity.…

Q: The pulmonary arteries carry blood

A:

Q: So how and why did Charles Darwin come to develop his ground-breaking Theory of Evolution?

A:

Q: What causes the transfer of electrons through an electron transport chain?  a. The initial "push"…

A: Introduction The electron transport chain is a collection of proteins and organic compounds located…

Q: r a 12-carbon saturated fatty acid, calculate the following: er of acetyl COA er of NADH produced…

A: In one pass through the fatty acid oxidation sequence one molecule of acetyl coenzyme A, 2 pairs of…

Q: where the three pl... 1 2 3 5 6 88 7 38 9 number of the structure affected by increased levels of…

A: Gland is a structure and is just like an organ but is involved of secretion of materials .  Glands…

Q: One industry that is in need of sustainable practices is the fishing industry. Which of the…

A: Fishing industry include the catching, processing, transportation, Distribution and Marketing of…

Q: 34°C Lab Data Tube 1 Green Light 3.3 3.5 3.7 3.8 4 Rate of volume change(- Time (min) 0 5 10 15 20…

A: Rate of photosynthesis for the green light: ROP = Rate of vol. change(Light) - Rate of vol.…

Q: Does this epidemic curve suggest a point source or propagated epidemic? Justify your answer. What…

A: A disease is caused by a deficiency or infectious particles.

Q: Who originally deserved Kudos for genetic engineering

A: Genetic engineering, often known as genetic modification or genetic manipulation, is the use of…

Q: I need help with a biology question for my homework. So it asks “second law of thermodynamics uses…

A: Introduction Thermodynamics is the study of the relations between heat, work, temperature and…

Q: Why can both DNA template strands not be replicated continuously.

A: Deoxyribonucleic acid (DNA) is a molecule that contains the biological instructions that make each…

Q: The classification of viruses are similar to the classification of organisms in the three domains of…

A: Viruses are microscopic pathogenic organisms which can only multiply inside a host cell and are…

Q: the pulmonary system does serve as the supplier of O2 and disposes the produced Co2. O True O False

A: Introduction  The respiratory system is a biological system in animals and plants that consists of…

Q: Compare the Gram negative and Gram positive cell wall. You may do this as a sketch or in a table…

A: Introduction :- A cell wall is the non-living component that protects the cell's outer layer. Its…

Q: were the three pl... G Free Printable D 1 2 CA 4 5 6 7 8 9 In response to high blood calcium levels,…

A: Regulation of blood calcium concentrations is important for generation of muscle contractions and…

Q: Discuss how excess carbon dioxide lead to a mass extinction in the Permian period.

A: A mass extinction event is when species disappear a lot quicker than they are replaced. This is…

Q: how the animals and plants of a healthy ecosystem are organized and interact.

A: Introduction : The natural connectivity between animals, plants, and their environment is referred…