The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence None 5'..A TG GAG G T ATTA TA G.. 3' A 5' ..A TG GGCGAGATAT TATA G.. 3' В 5' ..A TGGGCGAG GTA CTATA G.. 3' C 5'..A TGGCCGAGGTATTATA G.. 3' The region without a mutation s transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- -C Determine the molecular basis for each mutation and what effect there would be on the protein. Mutation Molecular Basis Effect on Protein

The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence None 5'..A TG GAG G T ATTA TA G.. 3' A 5' ..A TG GGCGAGATAT TATA G.. 3' В 5' ..A TGGGCGAG GTA CTATA G.. 3' C 5'..A TGGCCGAGGTATTATA G.. 3' The region without a mutation s transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- -C Determine the molecular basis for each mutation and what effect there would be on the protein. Mutation Molecular Basis Effect on Protein

Name: The following is the DNA sequence of the entire protein-coding region
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is thecoding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation.MutationDNA Se

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence ..ATGGGCGAGGTATTATA G.. 3' None 5' A ..A TGGGCGAGATATTATA G.. 3' 5' B ..ATGGG CGAGGT ACTAT A G.. 3 5' 5'..A TGGC C GAGGTATTATAG.. 3' The region without a mutation is transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- -C Determine the molecular basis for each mutation and what effect there would be on the protein. Mutation Molecular Basis Effect on Protein A Transition Transition Transversion Nonsense Synonymous Nonsynonymous Readthrough
A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ For each of the following mutations: A. State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change that occurs for the missense, nonsense, and silent mutations (ex. GAA -- GAT). C. For frameshift mutations, write out the entire mutant sequence with each codon clearly indicated (if the frameshift creates a new stop codon, end the sequence at the new stop). Using the wild type DNA sequence above as a guide : Write the amino acid sequence of the mutants. Mutant 1: transition at nucleotide 23 Mutant 2: T --> G transversion at nucleotide 29 Mutant 3: an insertion of “A” after nucleotide 14 Mutant 4: transition at nucleotide 7 Mutant 5: An insertion of GG after nucleotide 40 Mutant 6: transition at nucleotide 15 Mutant 7: a deletion of nucleotide 25
A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAAWhich of the following mutations would cause a missense mutation in the sequence shown above? Select one: a. Replacement of second thymine base with cytosine base b. Replacement of second guanine base with thymine base c. Replacement of last adenine base with guanine base d. Replacement of first guanine base with adenine base
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letter
Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?
1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Met - Leu - Arg - Ile - ... Type of mutation Wild type Met - Leu - Arg - Met - ... Met - Leu - [STOP] Mutant 1 transition Mutant 2 transversion Mutant 3 Met - Phe - Arg - Ile - ... transition Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond to each amino acid. The first codon has been filled in for you. Codon information can be found in the codon access table. Met Leu Arg Ile Answer Bank CỦA AUA CGU CGA AUG AUC AGA UUG CÚC
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútation