The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations can affect transcriptional and post-transcriptional regulation, match the results shown on the Northern (mature mRNA) to the mutations shown. The N lane shows the size and amount expected for non-mutated myosin mRNA. All samples were loaded at the top (-) side of the gel. Part 1. Which lane or lanes on the gel could be the result of mutation A? 00000 I lane 1 lane 2 lane 3 lane 4 lane 5 TATAA Mutation A. Deletion of indicated 2 nucleotides AUG TSS Mutation B. Deletion of 150 nucleotides N 1 2 3 4 5 UAA Mutation C. 3 nucleotides changed

The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations can affect transcriptional and post-transcriptional regulation, match the results shown on the Northern (mature mRNA) to the mutations shown. The N lane shows the size and amount expected for non-mutated myosin mRNA. All samples were loaded at the top (-) side of the gel. Part 1. Which lane or lanes on the gel could be the result of mutation A? 00000 I lane 1 lane 2 lane 3 lane 4 lane 5 TATAA Mutation A. Deletion of indicated 2 nucleotides AUG TSS Mutation B. Deletion of 150 nucleotides N 1 2 3 4 5 UAA Mutation C. 3 nucleotides changed

Name: The diagram shown represents the coding strand of the myosin gene. Mu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations canaffect transcriptional and post-transcriptional regulation, match the re

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations can affect transcriptional and post-transcriptional regulation, match the results shown on the Northern (mature mRNA) to the mutations shown. The N lane shows the size and amount expected for non-mutated myosin mRNA. All samples were loaded at the top (-) side of the gel. Part 1. Which lane or lanes on the gel could be the result of mutation A? --4 ТАТАА AUG UAA Only known regulatory region TSS Mutation B: Mutation C. A: 5-base 20 nucleotides 3 nucleotides deletion deleted changed N 1 2 3 4 5
The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations can affect transcriptional and post-transcriptional regulation, match the results shown on the Northern (mature mRNA) to the mutations shown. The N lane shows the size and amount expected for non-mutated myosin mRNA. All samples were loaded at the top (-) side of the gel. Part 1. Which lane or lanes on the gel could be the result of mutation A? ТАТА AUG UAA Only known regulatory region TSS Mutation B: Mutation C. 3 nucleotides 20 nucleotides deleted A: 5-base deletion changed 1 2 4 5 lane 1 lane 2 lane 3 lane 4 lane 5 OOO0O
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
(b) (c) Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3-TAC CGG TTG TGA AGC TGA ATC-5' Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. (i) (ii) (iii) (iv) Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. Specify which of the point mutations identified in (d) are redundant? For the given tRNA for Thrombin (Thr) write down all…
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. I Specify which of the point mutations identified in (d) are redundant?
Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79 exons. The mature mRNA measures 14,000 and codes for a protein with 3,685 amino acids. Abnormal expression of dystrophin leads to severe symptoms like muscle weakness and fatigability, a disease that is called muscular dystrophy. Most patients with muscular dystrophy become wheelchair dependent early in life. Cardiac muscle is also affected which results typically in premature death (~ second or third decade of life). Several mutations in this gene have led to the production of low levels of dystrophin or of a defective,…
Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.
Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…
The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.
You are working on a protein for a research project. The protein does not express well in prokaryotic expression systems so you decide to try a eukaryotic system, baker’s yeast, instead. As part of the expression system, you add a signal peptide to the protein so that it will be exported through the endomembrane system to the outside of the yeast cell. This makes purifying the protein much simpler. During the purification, you notice that the protein is heavier than it should be during gel filtration chromatography. This is confirmed by SDS-PAGE. What could be the reason that the protein has gained mass when expressed in the eukaryotic system?
I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…