Answered: The addition of poly(U) is important in…

Name: Give detailed Solution with explanation needed needed (please don't co
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give detailed Solution with explanation needed needed (please don't copy the answer The addition of poly(U) is important inthe degradation of mRNAs encodingwhich of the following proteins: RNApolymerase Histones Myosin Actin

Science

Biology

The addition of poly(U) is important in the degradation of mRNAs encoding which of the following proteins: RNA polymerase Histones Myosin Actin

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 15QP

See similar textbooks

Similar questions

A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There is more than one correct answer.) Gly–Ala–Cys–Val–Tyr
Melanosomes are specialized lysosomes that storepigments for eventual release by exocytosis. Various cellssuch as skin and hair cells then take up the pigment, whichaccounts for their characteristic pigmentation. Mousemutants that have defective melanosomes often have paleor unusual coat colors. One such light-colored mouse, theMocha mouse (Figure Q13–3), has a defect in the gene forone of the subunits of the adaptor protein complex AP3,which is associated with coated vesicles budding from thetrans Golgi network. How might the loss of AP3 cause adefect in melanosomes?
On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
"a messenger rna is 423 long how many amino acids it can code"
Give the translation of the segment of a polypeptide chain below. Specify your template strand. —ссстAс стссттс сттссссА — |||||||||||||||| ||||| -cC GATCGACGAA GGA ACCCC T-
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
The journey of a c f t r protein covering translation at ribosomes etc
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
The genetic code derives its specificity through what interactions? O hydrogen bonds that maintain the shape of the tRNAS O complementary base pairing between amino acids and TRNA complementary base pairing between RNA and mRNA ionic bonds between the small and large subunits of the ribosome O hydrogen bonding between the ribosomal subunits and the MRNA