Q: Which lab technique can you use to best answer these questions? How movable are membrane proteins?…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: How gene therapy treatment affect our future?
A: Gene therapy is the process of modifying genes in your body's cells to treat or prevent illness.…
Q: What are the applications of modern biotechnology in the field of engineering? b. What are the…
A: Introduction Biotechnology is the branch of science that deals with technology and biological…
Q: Download and read the attached review article…
A: Some cancer patients would only need one operation. Many patients, on the other hand, undergo a…
Q: Fluorescent Protein-Based Biosensors and Their Clinical Applications
A: Green fluorescent protein and its common proteins have shed light on many biological problems. The…
Q: Why is Research is now an integral activity in the organizations?
A: Research is a study which is detailed and careful in order to find out more information about the…
Q: B.Use the simple flow chart on the next page to outline the basic procedure of geneticengineeringin…
A: Genetic engineering is the process by which we make hybrid cell which is having better characters…
Q: could you make powerpoint presentation subtopics for Fluorescent Protein-Based Biosensors and Their…
A: In live-cell mechano transduction imaging and mechano pharmacological drug screening, biosensors…
Q: Complete the following tasks. You discovered that a species of bacteria can break down StyrofoamT…
A: Hi! Thank you for your question. As per the honor code, we are allowed to answer one question at a…
Q: Strategic intervention Materials for gene mutation for students to understand
A: Gene mutation: Gene mutation is the process in which a gene is formed and in the gene sequence a…
Q: Insights with the stem cell 10 sentences.
A: Introduction: Stem cells are found in the very early stage of embryo and these are undifferentiated…
Q: a. What are the applications of modern biological membranes in the field of engineering? b. What…
A: A bilayer of lipid molecules makes up the double sheet that makes up biological membranes. Generally…
Q: nges th
A: Pharmacist is the person who provides and delivers the medications to the patients after receiving…
Q: What orchestrates cell differentiation? Why is cell differentiation important? What does it lead to?…
A: Introduction :- Unspecialized cells become specialised through the process of differentiation to…
Q: Please help 33. Tissue engineering is the ability to grow cells in a laboratory. These cells are…
A: Introduction- Due to trauma or any other causes, body n=may lose the tissue and the human body's…
Q: Why it i
A: Functions like reimbursement, benchmarking, clinical and financial decision making, healthcare…
Q: (MRI device) 1. What are the ingredients? The device? 2. The working principle 3. What common…
A: Introduction Magnetic Resonance Imaging (MRI) is an imaging technique that uses radio waves and…
Q: uses of 1D and 2D polyacrylamide gel electrophoresis techniques
A: The technique of Gel electrophoresis is used or the separation of DNA fragments or macromolecules…
Q: nursing and molecular biology?asap
A: Relationship between Nursing and Molecular biology.
Q: Questions: 1. Write down the messenger RNA sequence when Gene F' is transcribed. 2. Write down the…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: Task 1: DNA Extraction To begin work on the bacterium, you begin by extracting its genomic DNA…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Show all working explaining detailly each step Solution should be typewritten with a computer…
A: The Rh factor means rhesus factor it's a protein found on the surface of RBCs known as Rh antigen.…
Q: Questions - Introduction 1. What kinds of materials obtained from a crime scene might contain DNA?…
A: As per the honour code, we are entitled to do only three questions at a time. Therefore I am…
Q: Answer True or False Ribosomes released from ER are immature and needs further processing
A:
Q: Activity 1.4: Essay.Direction: Explain your answer.Today, it is easy to make transgenic plants and…
A: Transgenic plants or animals is a genetically modified organism (GMO) whose DNA has been altered…
Q: 1.Transcription factors (TFs) bind to promoter sequences on DNA because the shape of DNA at that…
A: Transcription is a part of central dogma, in which the DNA molecule is converted into mRNA by…
Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…
A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…
Q: Elaborate on DNA capabilities
A: DNA or deoxyribonucleic acid is a macromolecule composed of two polynucleotide chains that coil…
Q: Task 3: How can genetic engineering help in solving genetic problems like the thalassemia
A: Thalassemia is a genetic hematological disorder, which is characterized by reduced hemoglobin in the…
Q: Bio-sensor is a device consisting of immobilized layer of biological material such as_______.a)…
A: Science is a term which is used for the study of the subject which is based on the facts and…
Q: Go Green Before the Green Goes by Nano What does it mean? Please elaborate.
A: It is critical to protect the environment so as to reduce the destruction of eco-systems caused by…
Q: How important it is to develop your skills in micropipetting in the field of Molecular Biology?
A: Micropipetting is a essential skill in molecular biology. It needs to be mastered successfully so…
Q: a. What are the applications of modern biology in biological membranes? b. What are the…
A: Biological membrane or bio-membrane is a selectively permeable membrane that creates a barrier…
Q: How do you use FISH(fluorescence in situ hybridization) to detect gene rearrangement? Describe an…
A: FISH is a molecular cytogenetic technique that employs fluorescent probes that bind to just those…
Q: 1. What are the basic components of a Fluorescence Microscope and what are the functions of each?…
A: Note: Please note that as per our company honor code, citing external references are not allowed.…
Q: FITT
A: introduction Understanding the F.I.T.T. rule assists you with making an exercise plan that will be…
Q: . If you are a genetic engineer, what organism do you want to manipulate? And why?
A: As per Bartleby Guidelines We have only ONE question You may repost rest of the Questions : Answer…
Q: A 45 years old patient comes to you with chief complain of neck pain along with stiffness and the…
A: Car accidents can involve the damage of many important areas of the body, and it is fatal if the…
Q: a. What are the applications of modern biology in biochemistry? b. What are the implications of…
A: Modern biology is a culmination of physics, chemistry and engineering aspects. This helps us realize…
Q: Greetings and thank you for your help Using 2 examples, explain how biology can be studied from a…
A: Biology is the study of life and living organisms.
Q: (ultrasound device) Components of the method of work
A: The technologies which aids in defining, diagnosing, treating and improving the well being of the…
Q: Give the meaning of: in vivo & in vitro ; biopsy & autopsy
A: In vitro and invitro is a term used to specify the things happening in a living organism. Likewise,…
Q: Calculate the scan time for a GRE with TR = 30 msec, NEX = 2, Ny = 256, for (a) a single slice and…
A: The gradient-echo (GRE) pulse sequence is also known as gradient recalled echo. The main purpose…
Q: Choose one of the four macromolecules and discuss the relationship between its structure and its…
A: A macromolecule, such as a protein, is a very large molecule. They are made up of thousands of atoms…
Q: I need to approximate the width of the paramecium. But, I think my calculations are wrong. Please…
A: On images, there is given a scale bar so that the actual sizes of the objects in the provided image…
Q: Learning Task 2: In the space below, attach three to five examples of household items/goods(wrapper…
A: Biotechnology has an impact on health and medicine. Scientists have been able to produce novel…
Q: . In one or two paragraphs, explain the potential advantages and disadvantages of nanotechnology in…
A: Nanotechnology is branch of science which concern about research and innovation to make things…
Q: purpose of coding.
A: Medical coding consists of the explanation of the diseases, trauma, and healthcare techniques from…
Q: how does flow cytometry analyzer works and help in hematology
A: Flow cytometry is an analytical device used in cell culture and blood analyzing and it can observe…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you pickedQuestion Completion Status: Use the codon chart below to help answer the questions: Codons Found in Messenger RNA Second Base U C G Phe Ser Тyr Тyr Stop Cys Cys U Phe Ser Leu Ser Leu Ser Stop Trp Arg. U Arg Arg Arg Leu Pro His Leu C Leu Pro His Pro Gln Leu Pro Gln lle Thr Asn Ser U A lle Thr Asn Ser lle Thr Lys Arg Arg Met Thr Lys Asp Asp Val Ala - Gly Gly Gly Gly Val Ala Val Ala Glu Val Ala Glu A. Transcribe the DNA sequence TACTAAACACCGATT into mRNA (do not include any spaces in your answer): B. Where in a Eukaryotic cell does the process in part A take place? C. Translate the mRNA sequence from above into the amino acid sequence (in your answer, use the 3 letter abbreviations from the table above, and separate each amino acid with a space): D. If a molecule of DNA contains 22% thymine, what percentage of cytosine would it have? Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All An First Base DCAGD CAGUCAGUCAG Third BaseAmino acid Large subunit of ribosome tRN4 Small subunit of ribosome mRNA Anticodon Submit Request Answer Chamon 4rl Torms of Use | Privacy Policy | Permiss
- Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp
- Please answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…Remaining Time: 1 hour, 07 minutes, 09 seconds. * Question Completion Status: A Moving to another question will save this response. Question 25 Multiple Choice Question (suggested time - between 1 and 2 minutes): Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the foillowing? O A. Attachment of a long poly(A) sequence at the 3'-end. O B, Joining of coding sequences (exons) together OC. Excision of non-coding sequences (introns). O D. Addition of the 7-methylguanosine cap at the 5-end. O E. Charging of an amino acid residue to the CCA-end A Moving to another question will save this response. ypQuestion:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'
- a. 0.02z3 ML Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis? 1-ribosome bonds amino acids together; 2-MRNA leaves the nucleus; 3- TRNA molecules pick up amino acids; 4-DNA double helix unwinds; 5-TRNA anticodon links with mRNÁ codon; 6-polypeptide chain completed; 7-MRNA binds to ribosome; 8-mRNA transcibed Select one: a. 6-5-7-3-2-1-8-4 b. 4-2-8-3-7-5-1-6 c. 1-8-6-7-5-3-4-2 d. 4-8-2-7-3-5-1-6 e. 1-2-3-4-5-6-7-8 When using the high power objective, you should not adjust the Select one:True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG