Tadpoles grown in ponds with large numbers of tadpoles have lower survival and growth rates than tadpoles grown in ponds with lower numbers of tadpoles. What causes the tadpoles growing in the pond with the high population to have decreased survival and growth rates?
Q: 9.Statement 1: Major histocompatibility complex proteins help the immune system recognize 'self' vs…
A: Immunity deals with the study of how body's immune system works against foreign pathogens to…
Q: If you have to choose the most obvious/important factor for a dominant transmission (between the…
A: The traits like dominant or recessive determine the inheritance patterns. These traits help in…
Q: VOCABULARY alensium stew blood vessel -
A:
Q: In control of ventilation, which of the following is the most important? PCO2 in the blood PO2 in…
A: The physiological systems involved in controlling breathing, or the passage of air into and out of…
Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…
A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…
Q: Cell determination is due to cytoplasmic effectors that cause the cell to irreversibly commit to…
A: Cytoplasmic determinants are special molecules which play a very important role during oocyte…
Q: Does Z-DNA have major and minor grooves? Explain.
A: Answer
Q: If you mated an F' bacterial cell with lacl+ lacP+ lacO+ lacZ+ lacY+ on the bacterial chromosome and…
A: β-galactosidase gene (PbBGal2A) from Paenibacillus barengoltzii expressed in E. coli; the enzyme…
Q: In fruit flies, gray body (G) is dominant to black body (g). If a male with a black body mates with…
A: A trait is a characteristic features that is unique to particular individual . A monohybrid cross is…
Q: What are the different applications of ELISA?
A: ELISA is the basic assay technique, known as enzyme-linked immunosorbent assay (also referred to as…
Q: Describe the reproductive cycle of a retrovirus, such as human immunodeficiency virus (HIV).
A: Introduction Viral infections are very harmful to mankind. In the post century where we faced the…
Q: 12Bacterial growth can be measured a. Directly by counting bacterial cells b. Indirectly…
A: Introduction The bacterial cell cycle entails the replication of DNA and the partitioning of…
Q: RNAi (or RNA interference) is the process of creating double-stranded RNA in the cells. Explain how…
A: * RNA interference (RNAi) also called as Post Transcriptional Gene Silencing whi h is an conserved…
Q: different kinds of waste produced in a Nuclear Medicine Department. What are the appropriate…
A: Nuclear Medicine Department The nuclear medicine department is that branch of science and medicine…
Q: How does carbon enter the atmosphere? Burning fossil fuels Cellular respiration O Both A and B…
A: Introduction :- An atmosphere is a layer (or layers) of gas that surrounds a planet and is held in…
Q: genotype (you hy unlisted components are wildtype): repp lacl* lacP+ laco* lacz*/ repPlacls lacP+…
A: * The lac operon consists of structural genes that codes befor proteins and regulatory genes that…
Q: What are the selective attributes and criteria used for the selection of algae strains with…
A: *Algae strains will be used mostly for production of renewable energy like biofuel * The main…
Q: A patient has reduced FEV1, and lower lung volumes overall. What is your diagnosis? the patient…
A: The quantity of air one can drive out of the lungs in one second is known as FEV1. Spirometry,…
Q: How many μ moles of acetaldehyde are required to allow complete oxidation of the pyruvate to 15µ…
A: the limited supply of NAD+ will deplete the reaction initially causing the reaction to stop, but…
Q: GQ#15: What do the following terms mean? Write your best answer on the space provided after each…
A: Evolution is the change in characteristics pf species from generation to generation. There are four…
Q: PROTISTS Supergroup Excavata Subgroup Fornicata Distinguishing properties Form cysts Important…
A: Protists are small eukaryotic organisms that come in a variety of shapes and sizes. Protists can be…
Q: A plant evolves a high level of poison that enables it to defend itself against insects. Soon an…
A: Evolutionary developmental biology is considered a new norm in evolutionary biology. It arose from…
Q: 4.Why does the right ventricle need to pump the blood to the lungs via the left and right pulmonary…
A: Heart is muscular pumping structure which is used to supply oxygen rich blood to all parts of body.…
Q: Natural Selection A Process of Evolution It wasn't until the year 1800 a man named Jean-Baptiste de…
A: Answer
Q: Draw the syn conformation of purine residues in Z-DNA.
A:
Q: 1. Epigenetic marks established at infancy will persist throughout an individual's lifespan. II.…
A: As a result, vitamins and biologically active components can transiently modify DNA methylation…
Q: A dominant gene that codes for white hair is represented by the symbol W. If a parent with the…
A: The dominant trait is the one that first appears or is visibly seen in organism. Even if only one…
Q: In Labrador retrievers, some puppies have pink noses and some have black. Labrador retrievers with…
A: *Given that In Labrador retrievers some puppies have pink noses and some have black noses * And…
Q: Sequencing genomes of the Lassa virus to test hypotheses about its spread is an example of the…
A: ANSWER;- Evolutionary medicine. Explain;- Recombination with the host or other organism happens when…
Q: Which of the following enzymes has the highest functional error? a) DNA Polymerase I b) DNA…
A:
Q: how has climate change affected the US
A: Climate change affected the United States.
Q: Describe the following in Corynebacterium diphtheriae infections (a) Toxigenesis
A:
Q: Embryo mRNA in dormant seeds is expressed at germination. O Pre-transcriptional control O…
A: Following synthesis, some proteins are dormant unless they are stimulated, which can be accomplished…
Q: friend tells you the following story. "My aunt just received a heart transplant. Her doctors warned…
A: * Here a friend tells that his aunt received heart transplant and doctors warned her body might…
Q: 8. In cats, S = short hair, s = long hair, XC = black coat, XC = yellow coat, and XCXC calico coat.…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: oxytocin gene due to methylation. II. Mice with hypermethylation of the agouti gene became obese and…
A: Membrane fracturing, physical or pharmacological opening of the cervix, and oxytocin injection,…
Q: cytosines are methylated most frequently in CG regions in the DNA
A: Cytosine is one of the four nucleo-bases found in the DNA and RNA, along with adenine, guanine, and…
Q: Which protein in erythrocytes is responsible for capturing oxygen in the air and delivering it to…
A: Red blood cells, also known as red cells, red blood corpuscles, erythroid cells, or erythrocytes,…
Q: Question 5 Early classifications of the polar bear were based on reproductive isolation from brown…
A: As early naturalists gained a better understanding of the diversity of creatures, they devised many…
Q: Why are nonnative species often considered a disturbance in an ecosystem? They increase mutations.…
A: Introduction :- Non-native species are organisms that do not naturally occur in a given area but are…
Q: In humans, hemophilia is an X-linked recessive gene and will only be expressed in females if they…
A: Hemophilia is a X linked recessive disorder so which is inherited in homozygous condition. In rare…
Q: The following is/are true about plate count EXCEPT a. A plate count is a count of viable or live…
A: The following is/are true about plate count EXCEPT a. A plate count is a count of viable or live…
Q: 25. selective pre-mRNA degradation happens in the cytoplasm after the mRNAs have been translated…
A: Introduction :- MRNA degradation is the process of removing mRNA that is no longer needed in the…
Q: Define death in physiological terms. We know that when the human heart stops beating, it can be…
A: The cardiovascular system is a network of arteries and veins in which the heart pumps blood. One of…
Q: Question 49 A group of antibiotic-resistant genes is known as a bundle. cassette. conjugate.…
A: Antimicrobial resistance develops whenever bacteria, viruses, fungi, and parasites evolve and no…
Q: RNA to DNA, Ribosome, cytoplasm DNA, nucleus, cytoplasm Proteins, Nucleus, ribosome Proteins,…
A: The process through which cellular ribosomes produce proteins is known as translation. A ribosome…
Q: female calico cat has patches of black and white due to random x-chromosome inactivation a.…
A: * Calico cats are always femal and they will displays red and black based colors depends on which…
Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…
A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…
Q: ndustrial effluent from a metal processing factory released Cu into a nearby river without any…
A: Introduction The act of observing and measuring the state and continuing changes in ecosystems,…
Q: 9. Some biologists contend that the term double fertilization is a misnomer and that the process…
A: Fertlizatiion is the process of the male gamete, sperm, fusing with the female gamete, the ovum,…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What if we were able to restore some critical salmon habitat, like the forests surrounding the spawning streams? To test this restoration, increase K to 40,000 fish. What would that do to the MSY value? [ Select ] Does this mean you would be able to harvest more or less fish? [ Select ]What is often true of a population of organisms with a type Il suvivorship curve? they produce few offspirng and invest more energy in each offspring they produce more offspring and invest little energy in each they have low death rates during early life stages they are equally likely to die at any ageIn the short term what willhappen to the levels aboveand below a population ofsecondary consumers of anumeric pyramid if a largenumber of individuals fromthis population dies?
- In Glacier Sea over the past 5 years the moon jelly population has been INCREASING. How will the walleye pollock population be affected?What are the two key concepts for this section? Listthree variables that affect the growth and decline ofhuman populations. How can we calculate the population change of an area? Define the total fertilityrate (TFR). How has the global TFR changed since1955? Summarize the story of population growth inthe United States. List six changes in lifestyles thathave taken place in the United States during the 20thcentury, leading to a rise in per capita resource use.In January 2010, a population of organisms had a size of 564. By the end of the year 109 of those individuals had died, but 384 were born. what is the net reproduction per capita for this population?
- What is the likely carrying capacity of the fish population using the data given above?The Barton Springs salamander is an endangered species found only inthree adjacent springs in the city of Austin, Texas. There is growingconcern that a chemical spill on a nearby freeway could pollute thespring and wipe out the species. To provide a source of salamanders torepopulate the spring in the event of such a catastrophe, a proposal hasbeen made to establish a captive breeding population of the salamanderin a local zoo. You are asked to provide a plan for the establishment ofthis captive breeding population, with the goal of maintaining as muchof the genetic variation of the species as possible. What factors mightcause loss of genetic variation in the establishment of the captivepopulation? How could loss of such variation be prevented? With theassumption that only a limited number of salamanders can bemaintained in captivity, what procedures should be instituted to ensurethe long-term maintenance of as much variation as possible?Plasmodium is a vector for mosquitos. It is a protozoan that is the causal agent of malaria, which is responsible for killing as many 855,000 people in 2013, the majority of them being children. Populations of mosquitos are strongly influenced by the availability of standing water for egg-laying and larval development. How might mosquito density, and thereby human mortality, be affected by patterns of rainfall?
- Are higher macroinvertebrate indicators of less or more stream health? Do different invertebrate species have different tolerances to pollutants, thus can be used as an indicator of stream health? does Aquatic vegetation has a greater influence on zooplankton or benthic macroinvertebraesWhat is often true of a population of organisms with a type IIl suvivorship curve? they produce few offspirng and invest more energy in each offspring O they produce more offspring and invest little energy in each Othey have low death rates during early life stages O they are equally likely to die at any ageSuppose that researchers wanted to examine the combined effects of an introduced predator (a trout) and the trematode parasite Ribeiroia on amphibian populations. To do this, they established frog populations in each of 40 artificial ponds. Each pond was assigned at random to one of four treatments (10 ponds per treatment): 1) neither trout or parasites were added to the pond (the "No trout, no parasite" treatment); 2) no trout were added but parasites were added ("No trout, parasite added"); 3) trout were added but parasites were not added ("Trout added, no parasite"); and 4) both trout and parasites were added ("Trout added, parasite added"). Each pond contained refugia where tadpoles could avoid attack by trout, to avoid fish predators driving frog populations to extinction in an artificial pond, unlike what typically occurs in a natural pond. After two breeding seasons, the researchers estimated the density of frogs in each pond. The results are shown in the table and the figure.…