Suppose that an investigative team conducted an RNA-Seq experiment on mouse liver cells. They found many sequences that contained no long stretches of consecutive triplet codons that could be translated into a protein. Such sequences are called open reading frames (ORFS) and suggest the presence of a gene. Which statement explains why the experiment detected long stretches with no ORFS? The reaction solution did not include the correct primer for the gene sequence. O The results suggest that the cells may be cancerous. O Site-directed mutagenesis during cloning altered the ORF sequences. O The RNA-Seq experiment detected noncoding RNA molecules.

Suppose that an investigative team conducted an RNA-Seq experiment on mouse liver cells. They found many sequences that contained no long stretches of consecutive triplet codons that could be translated into a protein. Such sequences are called open reading frames (ORFS) and suggest the presence of a gene. Which statement explains why the experiment detected long stretches with no ORFS? The reaction solution did not include the correct primer for the gene sequence. O The results suggest that the cells may be cancerous. O Site-directed mutagenesis during cloning altered the ORF sequences. O The RNA-Seq experiment detected noncoding RNA molecules.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?
a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
Examine the following sashimi plot from a transcriptomics experiment. The red peaks mostly RNA STAR on data 22; data 16; ar 34 2 1 545326 550237 555148 560059 O a. correspond to exons and represent respective coverage of exons O b. correspond to introns and represent respective coverage of introns
(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helix
Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. -The nucleotide length of each exon and intron is shown. -The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. a) draw what the processed mRNA will look like. Include the start codon on the mRNA and label the approximate locations of the 5’ UTR and 3’ UTR on the transcript. (You do not need to add the 5’ CAP…
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?