Q: List and describe three important processes are affected by DNA supercoilin
A: DNA supercoiling is reffered to as under or "overwinding' of DNA strands. It is a crucial process in…
Q: How is the melting curve of duplex DNA aff ected by adding a small amount of ethanol?
A: Melting curve analysis is an assessment of the dissociation characteristics of double-stranded DNA…
Q: If the length of E.coli DNA is 1.36 mm,can you calculate the number of base pairs in ECOLI?
A: DNA is the genetic material in E.coli. It has a circular DNA molecule 4.6 million base pairs in…
Q: 1f) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same…
A: Deoxyribonucleic acid is a particle made out of two polynucleotide chains that loop around one…
Q: In gel electrophoresis, are the DNA fragments attracted to, or repelled from the negative pole of…
A: Electrophoresis is a process where charged particles move under the influence of the electric field.…
Q: Why should the extracted DNA be immersed in TE buffer
A: Introduction DNA( deoxyribonucleic acid) the natural chemical of complicated molecular structure is…
Q: 1000bg 800b 500bd 300bd 100bg Identify the sizes of the DNA bands in the agarose gel above using the…
A: Agarose gel electrophoresis is a separation technique mostly used for DNA molecules. Where a sample…
Q: Does the addition of a histidine tag affect DNA polymerase activity and or processivity? Give a…
A: DNA polymerase is an important enzyme of dna replication and can add nucleotide triphosphates to 3’…
Q: How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect…
A: Before an answer is given, the process of DNA replication must be understood. First there are two…
Q: What fraction of the binturong genomic DNA would be considered to be "highly repetitive" DNA, based…
A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…
Q: How many microliters of the pGLO plasmid do you need if you want 5 micrograms of DNA and the plasmid…
A: formula used : DNA in ug = (concentration of DNA / pGLO plasmid in ug/ul) ×(volume of DNA in ul)
Q: Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect)…
A: The double stranded DNA, as the name suggests has two strands while the denatured DNA contains just…
Q: Which Strict Operating Requirements DNA Polymerase Has?
A: DNA polymerase is an enzyme involved in the synthesis of nucleotides. These are important for the…
Q: How would describe the observation of DNA precipitated out of the water-ethanol solution
A: Ethanol precipitation is a process where ethanol is used as an anti-solvent to purify and…
Q: You have received a dehydrated sample of DNA primer at a concentration of 19.9 microM. what volume…
A: Asked : Volume (in microL) of buffer to get a solution of 100nM primer from 19.9 microM dehydrated 1…
Q: onsidering the number of base pairs, compute for the actual length (in micrometers) of this DN
A: There are 7 base pairs. Length of one base pair is 3.4 Angstrom. Length of 7 base pairs is 3.4 X 7=…
Q: Extracting DNA From Strawberries Is isopropyl alcohol polar or nonpolar? Explain
A: DNA extraction is used to isolate dna molecule from the cells . It helps in removing impurities and…
Q: 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…
Q: what type of gel(in terms of material) can be more suitable for the electrophoresis of 500-1000bp…
A: DNA tests are stacked into spaces toward one side of a gel, and an electric current is applied to…
Q: Unknown 150 bp 250 bp 400 bp 700 bp mnipcrt pivot bio interactives GEL Change Gel 3
A: The restriction fragment length polymorphism technique (RFLP) "cuts" out genes which are likely to…
Q: When a segment of DNA containing either aVNTR or an RFLP is analyzed, the result is fragments of DNA…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: It was once thought that the DNA polymerase machinery moves along DNA in a manner analogous to a…
A: DNA polymerase is defined as the family of enzymes responsible for catalyzing the synthesis of new…
Q: You have discovered an enzyme secreted by a particularly virulent bacterium that cleaves the C2′—C3′…
A: Introduction: DNA, also known as deoxyribose nucleic acid is made up of nucleotides which comprises…
Q: Can you please help with 1b please. picture with 1 graph is for question 1a) picture with 4 graphs…
A: Denaturation refers to the breaking of the double-stranded DNA into single strands. It is carried…
Q: Can you please help with 1c please picture with 1 graph is for question 1a) picture with 4 graphs…
A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…
Q: Similarities between DNA agarose gels and SDS-PAGE are:
A: Gel electrophoresis is the technique of separation of molecules of the basis of their size and…
Q: What is the role of alcohol in extracting DNA? O DNA is a polar molecule with an overall negative…
A: DNA is deoxyribonucleic acid, is a nucleic acid it is deoxy in the 2nd Carbon that makes DNA more…
Q: ! (please help ASAP)
A: DNA is also known as deoxyribonucleic acid. DNA is composed of four types of nucleotides attached…
Q: The following gel was produced in manual DNA sequencing. What would the unknown DNA template be that…
A: Answer :- In Sanger manual sequencing, DNA of interest is amplified along with dye-labeled chain…
Q: Why evenly spaced sequence in chromatogram is an indication of a good DNA chromatogram?
A: The characteristics of an evenly spaced sequence are:- Evenly-spaced peak, each being…
Q: If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample…
A: DNA is composed of two polynucleotide chains that coil around each other to form a double helix. It…
Q: 1c) What fraction of the binturong genomic DNA would be considered to be "highly repetitive" DNA,…
A: Deoxyribonucleic acidi an atom made out of two polynucleotide chains that curl around one another to…
Q: A batch of this DNA is first fully digested by HpaI alone, then another batch is fully digested by…
A: The restriction enzymes clean the nucleotide fragment at specific sides called the restriction…
Q: why does a higher agarose concentration render better resolution/separation of smaller DNA…
A: Electrophoresis is an essential lab procedure at the molecular level that uses an electric field to…
Q: proteins are denatured and eliminated during the DNA extraction process. how can we determine the…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: Are all the proteins separated properly using two-dimensional (2D) gel electrophoresis? Why or why…
A: Two dimensional gel electrophoresis is an analytical technique that uses two techniques i.e.…
Q: Explain why we choose to use 1% agarose gel for Electrophoretic Analysis of DNA via Agarose gel…
A: Answer: Agarose Gel Electrophoresis : It is the gel electrophoresis technique which is used to…
Q: How many bands of DNA would be expected in Meselson and Stahl’s experiment after two rounds of…
A: Meselson and Stahl’s experiment: This experiment proves the nature of DNA replication by using the…
Q: ollowing base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true…
A: DNA polymerase is the enzyme used for the replication of DNA. The polymerase uses the template DNA…
Q: Supercoiled DNA is more compact than relaxed DNA of the same molecular weight, which gives…
A: DNA supercoiling refers to the over or under-winding of a DNA strand, and is an expression of the…
Q: What is a processive enzyme? Explain why processivity is an important feature of DNA polymerase.
A: Enzymes are substances produced by living organisms to carry out reactions at a high rate without…
Q: True or false: The synthesis of a new strand of DNA is initiated using a DNA primer?
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: We use 3.16 fold dilution why this dilution schedule is important to determine unknown DNA…
A: The dilutions are the geometric series i.e Serial dilutions are prepared using same dilution step as…
Q: True or false: During DNA replication, the DNA template is read 3 ́ to 5 ́ by a DNA polymerase, as…
A: DNA replication is a biological process in which two identical copies of DNA are formed during cell…
Q: All the DNA extraction protocols suggest adding salts to the extraction buffer. What is the role of…
A: * Dna extraction can be done in following steps Breaking cells to release the DNA Separating DNA…
Q: Explain why DNA fragments migrate in a gel electrophoresis. Which fragments migrate farthest: large…
A: Introduction :- The technique of gel electrophoresis is used to separate DNA fragments based on…
Q: Human cells have approximatelly 6,000,000,000 base pairs. How many errors per replication occur?
A: Human cells have approximatelly 6,000,000,000 base pairs. How many errors per replication occur?…
Q: What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme…
A: Axial distance between nucleotides in B- DNA is 3.4 R catalytic rate of DNA polymerase 111 is 1000…
Step by step
Solved in 2 steps
- U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyKha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
- You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.How many microliters of the pGLO plasmid do you need if you want 5 micrograms of DNA and the plasmid concentration is 100 nanograms/microliter?Hi, this is my Recombinant "Paper" Plasmid activity question, I did other parts, but this question I really have no clue what it is. Question: What polypeptide sequence does the inserted gene code for? (Review protein synthesis and write the full amino acid sequence for the inserted gene.) in the picture attached: I Draw a ring symbolizing my plasmid that has been recombined with another gene. it shows the following: • where inserted gene is located on your loop. • where the origin of replication is located. • which antibiotic resistant genes (R – genes) I preserved and what sequential order is • Name and where your restriction enzymes (endonucleases) cut.
- PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |Give typed full explanation you made a recombinant plasmid (it is circular) that contains the sequence 5' AAGCTT in the middle of the inserted or cloned gene. that is the only place where this sequence occurs. the entire plasmif does not have 5' GAATTC. When putting this plasmid into E. coli (transformstion) what will happen? 1. plasmid will cut into several fragments 2. nothing the plasmif with remain circular 3. plasmid will be cut once making a linear dna fragment 4. will be cut once but will becomr two linear fragmentsYou are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E H E+H E+X H+X Kb +4.3 +2.8 +2.5 - +2.0 -- -1.8 -1.5 12 +1.0 +0.8 +0.5 - a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?
- Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )The transformation results below were obtained with 10 ul of intact plasmid DNA at nine concentrations. The following numbers of colonies are obtained when 100 ul of transformed cells are plated on selective medium: Fill in the following table: Concentration # colonies DNA mass of Fraction of Mass Transformation PGREEN (Concentration x volume OR X spread = x 10ul plasmid solution) PGREEN in cell Cell efficiency Y÷ A suspension suspension spread = 100 ul - total vol cell susp. (Colonies - Mass spread) C x Z = A See (510 ul) HINT: this calculation is constant Given= X Given=Y С. Z. 0.00001 ug/ul | 4 0.00005 ug/ul 12 0.0001 ug/ul 0.0005 ug/ul 32 125 0.001 ug/ul 442 0.005 µg/ul 0.01 ug/ul 0.05 ug/ul 0.1 ug/ul 542 507 475 516 0.5 ug/ul 505vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA