Skin color in humans is an example of an evolutionary trade-off: a situation where a trait that is an advantage in one context is a disadvantage in a different context. Darker skin protects DNA from damage due to ultraviolet radiation (an advantage) but makes it harder for the body to produce vitamin D (a disadvantage). Based on what you’ve learned, which of the following describe other examples of evolutionary trade-offs? Select all that apply. A. Some genetic variations that protect humans from malaria, a disease transmitted by mosquitoes, also causethe blood disease thalassemia.B. Some garter snakes have mutations that make them resistant to a toxin found in their prey, rough-skinnednewts. Snakes with these mutations move more slowly and may not be as good at hunting or avoiding predators.C. Alleles that caused the loss of body hair allowed humans to lose heat more easily in hot environments. This inturn helped humans walk and run for longer distances to hunt large animals.D. The common Mormon butterfly is not toxic to birds and other predators. Some common Mormons havegenetic variations that make them resemble toxic butterflies, which deters predators. In places without predators,common Mormons with these variations don't live as long as other common Mormons.

what is evolutionary trade offs.. It is a situation in an organism where changes in traits brings…

Skin color in humans is an example of an evolutionary trade-off: a situation where a trait that is an advantage in one context is a disadvantage in a different context. Darker skin protects DNA from damage due to ultraviolet radiation (an advantage) but makes it harder for the body to produce vitamin D (a disadvantage). Based on what you’ve learned, which of the following describe other examples of evolutionary trade-offs? Select all that apply.

Skin color in humans is an example of an evolutionary trade-off: a situation where a trait that is an advantage in one context is a disadvantage in a different context. Darker skin protects DNA from damage due to ultraviolet radiation (an advantage) but makes it harder for the body to produce vitamin D (a disadvantage). Based on what you’ve learned, which of the following describe other examples of evolutionary trade-offs? Select all that apply.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter26: Human Evolution

Section: Chapter Questions

Problem 1DAA: Neanderthal Hair Color The MC1R gene regulates pigmentation in humans (Sections 14.1 and 15.1...

See similar textbooks

Similar questions

a. Which gene is mutated in individuals with sickle-cell anemia? b. What are the major symptoms of this disorder? c. What was the first published scientific description of sickle-cell anemia? d. Describe two other features of this disorder that you learned from the OMIM database and state where in the database you found this information
An adaptation isa. any trait that arises from a mutation.b. a trait that increases the reproductive success of its bearer.c. any trait that changes during the lifetime of an organism.d. a trait that arises due to gene flow or genetic drift.
Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colon
About 9 percent of Caucasian males are color-blind andcannot distinguish red-colored from green-coloredobjects.a. Offer one genetic model for color blindness.b. Explain why and how color blindness has reached afrequency of 9 percent in this population
You are a studying the genetic basis of horn color in unicorns. Gene C determines the color of pigment destined for the horn by converting a pink precursor into a purple pigment. C- individuals make purple pigment whereas cc individuals accumulate pink precursor. Gene D ensures the deposition of the pigment into the horn cells, such that D- individuals have a colored horn (purple or pink), whereas dd individuals have a white horn. You breed two purple horned unicorns to each other (CcDd). Assuming Gene C and Gene D are unlinked, what is the probability that the baby unicorn has a purple horn? Please express your answer to 2 decimal places (e.g. 0.69).
A mutation in a coding region of DNA, but that does not change the amino acid, would almostcertainly be considered a(n) ____________ allele.And this kind of mutation is also called ___________ .b. Most nonsense mutations would create __________ alleles.However, describe a situation in which a nonsense mutation would create an isomoprh allele.c. A missense mutation will usually create a(n) _________ allele.However, describe a situation in which a missense mutation would create a neomorph allele.
Explain why you agree or disagree with each of thefollowing statements:a. We should not worry much about exposure totoxic chemicals because almost any chemical, at alarge enough dosage, can cause some harm.b. We should not worry much about exposureto toxic chemicals because, through geneticadaptation, we can develop immunities to suchchemicals.c. We should not worry much about exposureto toxic chemicals because we can use geneticengineering to reduce our susceptibility to theireffects.d. We should not worry about exposure to a chemical such as bisphenol A (BPA) because it has notbeen absolutely proven scientifically that BPA haskilled anyone.
Insect wings are coded for by the same gene that creates... A. internal air branches (trachea) B. Their cuticle C. their antennae D. parts of crustacean appendages, like legs
Which of the following statements does NOT describe an environmental influence on the expression of a gene? Select one: a. Siamese cats have darkened paws, nose, and tip of tail due to a gene that allows their skin and fur to darken in the parts of their bodies that need to retain more heat, their extremities. b. More than a single gene is involved in the expression of human height, weight, and skin colour. c. Exposure to sunlight increases melanin production in human skin. d. Colder incubation temperatures of gecko eggs yield more females and warmer temperatures yield more males.
study for the Genetics and Here 9948/lessons/1533885/variants/1533885/take/5/ Alert 1 of 1: Instructional Technology Subsidy Up.. DISMISS C. karyotype diagram that shows how a trait is inherited in a family d. carrier structures of DNA and histones that form during cell division e. amniocentesis procedure used on a pregnant woman to check the fetus for ge f. pedigree netic abnormalities g- nondisjunction failure of homologous chromo- somes to separate during meiosis h. chromosomes all the DNA in a species inserting normal genes into cells with mutant genes 47°F Mostly cloudy
When mice carrying the Avy allele exhibit a darker coat, thisphenotype is thought to be caused by dietary factors thatresult ina. a greater level of DNA methylation and a decrease in theexpression of the Agouti gene.b. a lower level of DNA methylation and a decrease in theexpressionof the Agouti gene.c. a greater level of DNA methylation and the overexpressionof the Agouti gene.d. a lower level of DNA methylation and the overexpression ofthe Agouti gene.
Muscle cells differ from bone cells because they_______ . a. carry different genes c. are eukaryotic b. express different genes d. are different ages