Sketch the following two tripeptide chains: Asp-Gly-Ser and Ile-Asn-Met at physiological pH . Please provide only typed answer solution no handwritten solution needed allowed
Q: 4 Using the structures you drew in questions 2 & 3, for each of the organic functional groups listed…
A: The structures of the compounds from questions 2 and 3 are given below (lecithin) The…
Q: Differentiate reducing sugars from non-reducing sugars
A: Sugars are carbohydrates or saccharides. Sugars are ketone or aldehyde derivatives of straight-chain…
Q: he human body requires various nutrients which are essential for health and can be obtained from a…
A: Proteins are comprised of amino acids polymer linked by peptide/amide bonds. Fats are insoluble…
Q: .Here is an oligomeric protein, which has two binding sites: 1)Write the formulas of side chains of…
A: Oligomeric proteins are quaternary structure proteins which possess more than one subunit of…
Q: A mixture of three peptides is provided to you. The sequences of the three peptides are known: 1.…
A: Proteins are complex, high molecular weight biopolymers made up of 20 different amino acids linked…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: Serine, histidine, and aspartate all are amino acids. They all have different properties and…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: The central dogma of molecular biology explains how the nucleotide sequence in DNA acts as a…
Q: 10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12.…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: 1. What is gluconeogenesis? 2. Explain the biochemical effects underlying the metabolic functions of…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Question 1 Amyloid Precursor Protein (APP) is actually thought to be a natural neuroprotective agent…
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: CHOOSE THE ANSWER FROM THE FOLLOWING CHOICES: Phosphodiester Bond Glycosidic Bond Ester…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…
Q: Two common methods of denaturing proteins in the lab are to increase the temperature and/or add…
A: Proteins are biomolecules with diverse biological roles. The function of a protein depends on its…
Q: If you are a medical technologist, which of the four methods of glucose determination would you…
A: Determination of glucose level in blood and urine helps us to diagnose diabetes and many other…
Q: Clinical Chemistry The concentration of Nations in red blood cells (11 mM) and in the surrounding…
A: The unequal separation of ions across a membrane will lead to the generation of a potential…
Q: Qualitative Tests for Carbohydrates: Sugar Solution Glucose Sucrose Lactose Hydrolysis: Molisch's…
A: Qualitative tests for carbohydrates are done to confirm the presence of carbohydrates in a sample,…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: The question stated the standard free energy change not the actual free energy change. You solved…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: Draw an approximate titration curve for lysine, given that its pKa(COOH) = 2.18, its pKa(NH3*) =…
A: Amino acid has a typical structure. It has a central Carbon atom called (Cα). To it 4 groups are…
Q: In an enzyme-catalyzed reaction where enzyme concentration is held constant and substrate…
A: Enzymes are biological catalysts. They increase the rate of the reaction they catalyze. There are…
Q: True of false 6. In glycogen synthesis, the active form of glucose is UDPG. () 7. If people lack…
A: Glycogenesis : It is the process of synthesis of glycogen from glucose. Glycogen is a polymer of…
Q: Discussion topic: Food additives are in many of the foods we eat. They get into foods either by…
A: Food additives play a crucial role in the food industry, but their use is surrounded by controversy,…
Q: What is the main source of energy for ATP replenishment for ATP-PC system
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: Identify what GalNAc, GlcNAc, Frutose and Sialic Acid are, draw them and describe their…
A: Carbohydrates chemically are polyhydroxy aldehydes or ketones. They serve diverse function roles…
Q: compare that hypothetical mechanism to the classical presentation described in our textbook. What…
A: ETC is an arrangement of protein complexes and some non-protein components in an increasing redox…
Q: 1. Calculate a creatinine clearance and its reference range. 2. Explain the biochemical formation…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Uracil and Adenine are two nitrogen bases constitutive of RNA. Both compounds show maximum…
A: The Beer Lamberts equation relates the absorbance value given by an analyte for a particular…
Q: Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene…
A: Mutations in the following gene gives rise to a genetic disorder known as Xeroderma pigmentosum.…
Q: Two theories of membrane structure are discussed below. Unit Membrane Model Phospholipid molecules…
A: Membrane of the cell is also known as the plasma membrane or the cell membrane. The membrane is an…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. a)…
A: Our body primarily uses glucose as a source of energy. In order to carry out the normal functions of…
Q: Close circuit of tubes through which blood flows
A: The function of blood flow is to deliver oxygen to the different tissues and organs. Blood flow also…
Q: rue or false 1. Cytochrome p450 is considered to be the “universal oxygenase” 2. In alzheimer’s and…
A: Oxygenases are enzymes that oxidise substrates with molecular oxygen. PD and AD are neurological…
Q: How many total (NOT NET) molecules of ATP are synthesized from ADP via glycolysis of a single…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: The acronym DFR stands for what?
A: Biomolecules often have long complex names. The use of acronyms helps us simply the name of complex…
Q: Consider the following peptide: alanyl-glutamyl-lysyl-cysteyl-asparagine. 1- Write the…
A: The given peptide is comprised of 5 amino acids. In order to write the name of a peptide , we add…
Q: Qualitative Tests for Carbohydrates: Sugar Solution Glucose Sucrose Lactose COLOR OBSERVED Molisch's…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Which type of protein is classified by a polypeptide which is arranged in long strands or sheets?…
A: Each and every live cell has proteins. Protoplasm, cell membranes, and nuclear material all include…
Q: Discuss how the cell uses RNA molecules to synthesize proteins.
A: The majority of living things and viruses include the molecule known as ribonucleic acid (RNA). It…
Q: 1. Discuss the 2 mechanisms by which Chloride maintains electrical neutrality.
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Design an assay with purified phycocyanin to test protein stability using 500ml of 95% ethanol. Then…
A: Phycocyanin is a pigment that is found in cyanobacteria and algae. It’s a member of the…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. b)…
A: Insulin (release from the beta cells of pancreas) and glucagon (release from the alpha cells of…
Q: Biochemical significance of transamination reactions
A: The reactions that involve the transfer of amino group from an amino acid to a keto acid to form a…
Q: An enzyme facilitate catalysis by formation of ester bond with an alcoholic substrate. Which amino…
A: Ester bond: The bond that is formed by the condensation of alcohol group with a carboxylic acid…
Q: The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn…
A: Proteins are polymers of amino acid residues linked via peptide bonds. Amino acids are biomolecules…
Q: The measurement of alanine aminotransferase activity (reaction rate) usually includes an excess of…
A: If a particular reaction brings about a measurable change (like the generation or consumption of a…
Q: Which fibrous protein is found in connective tissue and consists of 3 left-handed helices twisted…
A: Fibrous proteins are a large class of proteins which provide strength and/or flexibility to the…
Q: Question 1 Signal sequences direct their delivery to different locations in the cell or outside the…
A: The proteins are made of twenty naturally occurring amino acids that are linked via peptide…
Q: what is environemental independence tolerance and metabolic tolerance
A: Tolerance is the term used to describe the resistance developed towards a stimulus over a period of…
Q: What is the total number of H+ transferred from matrix to intermembrane space of the mitochondria by…
A: Complex I, II, and III are the part of the electron transport chain or oxidative phosphorylation.…
Q: Which of the following statements is NOT true of biological organic molecules? Their atoms are…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Sketch the following two tripeptide chains: Asp-Gly-Ser and
Ile-Asn-Met at physiological pH .
Please provide only typed answer solution no handwritten solution needed allowed
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- An oligopeptide has the following amino acid sequence: NH2-Ala-Glu–Leu–Trp–Tyr-Ser–Gly–Lys–Leu-Ala–Arg-Ala-Phe-Ile-Pro–Gly-COOH a) Estimate the net electric charge of the molecule at pH 8.0 and pH 11.0. b) If the above peptide is passed through a cation exchange chromatographic column (that is, the matrix of the column has negative charges) stabilized at pH 8.0, would you expect it to be retained on the column? c) Indicates the number of fragments, and the sequence of each of them, that would be obtained when treating the peptide in question with: i) trypsin, ii) chymotrypsin.A tripeptide has the following sequence: Glu-Trp-Arg What is the net charge of this tripeptide at physiological pH?Consider the peptides Pro-Gin-Val-Phe-His-Asp-Cys and His-Gln-Pro-Cys-Asp-Phe-Val. How do these two peptides differ? (Select all that apply.) The two peptides have different compositions. The two peptides have different isoelectric points. The two peptides have different titration curves. The two peptides differ in amino acid sequence. [References] If you were to have a mythical amino acid based on glutamic acid, but one in which the hydrogen that is attached to the y-carbon were replaced by another amino group, what would be the predominant form of this amino acid at pH 12 if the pK, value were 10 for the unique amino group? (Select all that apply.) Both of the carboxyl groups are deprotonated. The amino acid-carries a negative 2 charge. The amino acid carries a negative 4 charge. The amino groups are in the form -NH". Both of the amino groups are deprotonated.
- Consider the peptide Trp-Arg-Glu-Cys-Gly-Tyr. For the drawings requested below, please show them in zig-zag style, from amino to carboxy terminus, with correct stereochemistry Draw the predominant form at pH = 2 Draw the predominant form at pH = 5 Draw the predominant form at pH = 7 Draw the predominant form at pH = 12The key reaction steps in the Edman degradation of polypeptides, which removes the N-terminal amino acid in the form of a "phenylthiohydantoin" (PTH-amino acid), are shown below. What is the expected outcome if the N-terminal amino acid is proline (Pro)? (The structure of proline is provided below for your reference.) NH-C00 NH CO0 phenyl isothiocyanate PITC NH CO0 NH CO0 peptide without the thiszolinone original Nterminal amino acid HE a PTH-amino acid Proline: HN HN. O Edman's reagent will not react with an N-terminal proline.Porcine dynorphin is a neuropeptide having 17 amino acid residues. Its structure is shown below. Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln 8. How does trypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C-terminal end. 9. List down the different fragments that would result if dynorphin were cleaved by trypsin. 10. How does chymotrypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C- terminal end. 11. List down the different fragments that would result if dynorphin were cleaved by chymotrypsin. 12. Cyanogen bromide is a chemical reagent which also cleaves peptide bonds.…
- Hydrolysis of dodecapeptide P with the enzyme trypsin affords the following fragments: Arg, Ser-Tyr-Ser-Met-Lys, Ala-Gly-Asp-Phe-Glu-Arg. Hydrolysis with chymotrypsin yields: Glu-Arg, Arg-Ser-Tyr, Ser-Met-Lys-Ala-Gly-Asp- Phe. What is the amino acid sequence of P? Submit Answer Retry Entire Group 9 more group attempts remainingConsider the following peptide: Lys-His-Asp-Glu-Phe-Cys-Ala-Asp-His-Arg What is the net charge of this peptide at pH = 1? What is the net charge of this peptide at pH = 14?Porcine dynorphin is a neuropeptide having 17 amino acid residues. Its structure is shown below. Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln How does trypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C-terminal end. List down the different fragments that would result if dynorphin were cleaved by trypsin. . How does chymotrypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C- terminal end. List down the different fragments that would result if dynorphin were cleaved by chymotrypsin. . Cyanogen bromide is a chemical reagent which also cleaves peptide bonds. What is/are…
- write the one letter code for oligopeptide ser-cys-ille-glu-Asn-cys-glu and calculate the total charge on it at pH 4.5 (pKa of Glu side chain is 5.0)The enzyme creatine kinase catalyzes the ATP-dependent phosphorylation of creatine. Propose a mechanism for the reaction described using the curved arrow convention. Show the complete structure of the nucleotide.The melanocyte-stimulating peptide hormone α-melanotropin has the following sequence: Ser–Tyr–Ser–Met–Glu–His–Phe–Arg–Trp–Gly–Lys–Pro–Val(a) Write the sequence using the one-letter abbreviations.(b) Calculate the molecular weight of α-melanotropin, using data in as shown.