Shown in the following table are several amino acid substitutions in the a and B chains of human hemoglobin. Use the genetic code table in Figure 12.7 to determine how many of them can occur as a result of a single nucleotide change. Substituted НЬ Туре НЬЈ Toronto ньЈ Оxford Normal Amino Acid Amino Acid Ala Asp (a-5) Gly Asp (a-15) Hb Gln lu (a-54) НЬ Bethesda Tyr His (B-145) Hb Sydney Val Ala (B-67) HbM Saskatoon His Tur (R-63)
Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…
A: DNA replication being very complex process, there are chances of miss reading the DNA template and…
Q: Glutamic acid (Glu) is encoded by GAA and GAG, while Glutamine (Gln) is encoded only by CAA and CAG.…
A: The base sequence provided in the picture given in the question is CUC as the anti codon which means…
Q: Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a…
A: the minimal mutational distance is
Q: A glycine residue is in position 210 of the tryptophan synthetase enzyme of wild-type E. coli. If…
A: Single base substitutions in which change in only one base pair occurs.
Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…
A: Introduction A mutation is a change in the DNA sequence that may occur due to incorrect…
Q: The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: Which of the following best represents the amino acid sequence found in normal adults with the HBB…
A: The Hemoglobin beta chain gene consists of code for 146 aminoacid sequences, where each amino acid…
Q: Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…
A: Sickle cell anemia occurs due to point mutation in a gene for hemoglobin. Its symptoms are - fatigue…
Q: Is it possible to have a mutation in nucleotide four that would produce the same amino acid? If yes…
A: A nucleotide is an organic molecule that is the building block of DNA and RNA.They also have…
Q: Identify the polypeptide that is found with a-globin in human fetal hemoglobin (first appearing in…
A: Fetal hemoglobin helps in carrying of oxygen in fetus. It is synthesized at about six weeks of…
Q: The 20 different amino acids in the protein are normally coded by ------ nucleotides. * 60 61 62 63
A: Nucleotides are building blocks of nucleic acids. Three mRNA nucleotides present together are known…
Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…
A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…
Q: Approximately 1 in 100 West Africans suffer from sickle-cell anemia. Given the often devastating…
A: A genetic disorder is a disease, which is caused by abnormalities in a person’s Deoxyribonucleic…
Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…
A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…
Q: between gene and protein was first articulated by Beadle & Tatum, who proposed the one-gene,…
A: The one gene–one enzyme theory proposes that genes work by making enzymes, with each gene producing…
Q: N-formylmethionine is the amino acid specified by a tRNA molecule carrying the anticodon sequence…
A: N-formylmethionine, abbreviated as N-fMet, is a derivative of the amino acid Met (methionine) in…
Q: Which of the following statements is true regarding the formylmethionine that serves as the first…
A: Introduction Protein synthesis:- The process by which amino acids are linearly arranged into…
Q: Given below is the electrophoretic profile of 2 proteins, a normal hemoglobin, HbA and the fetal…
A: Protein electrophoresis is a method that separates proteins based on their size and the electrical…
Q: When comparing the a-globin protein in cow and humans, you find that they differ at 17 of the 149…
A: Amino Acid: Amino acids are the building blocks of proteins. The building blocks of life are amino…
Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…
A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…
Q: Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the…
A: Sickle-cell anemia is a genetic disease characterized by the sickle shape of the RBCs. It results in…
Q: Sickle cell disease is a medical condition involving the mutation of a single nucleotide in the HBB…
A: Sickle cell anemia is a genetic disorder that affects RBCs or Red Blood Cells. More specifically,…
Q: Although ultimately coding for all aspects of a protein, the gene codes directly only for what level…
A: DNA is made up of many nucleotides. Each nucleotide is made up of phosphate , a pentose sugar, and…
Q: 46. Identify the polypeptide that is found with a-globin in human fetal hemoglobin (first appearing…
A: Fetal hemoglobin is the oxygen carrier protein found in human fetus. Fetal hemoglobin is present in…
Q: Which of the following are encoded in the terminating codon in protein synthesis? a.…
A: The process of formation of protein molecules is known as protein synthesis. The process of protein…
Q: N-formylmethionine is the amino acid specified by a tRNA molecule carrying the anticodon sequence…
A: N-formylmethionine It is use as starting amino acids during the synthesis of proteins in…
Q: List all possible codons present in a ribonucleotide polymer containing U and G in random sequence.…
A: Molecular biology is the study of biology at a molecular level. It studies the composition,…
Q: How many PAM sequences are present in the sequence below?…
A: Protospacer adjacent motif(PAM) sequence It is a short DNA sequence(usually 2-6 base pairs in…
Q: Match the following protein pair with whther they are orthologues, paralogues or neither.…
A: Homologous genes are those gene that share a common evolutionary ancestor. A pair of homologous…
Q: Shown in the table are partial sequences (coding strand) of the normal human hemoglobin and three…
A: Introduction Hemoglobin, often known as Hb or Hgb, is an iron-containing oxygen-transport…
Q: Figure shows a part of the sequence alignment of human and whale myoglobin proteins. Please explain…
A: The condition represented in the sequence alignment is amino acid replacement. In amino-acid…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: Consider the genes that specify the structure of hemoglobin. Arrange the following events in the…
A: Hemoglobin is present in red blood cells.Hemoglobin is made up of heme and oxygen molecule and…
Q: Consider an amino acid sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: when XRCC2 DNA sequence CTC is changed to CCC (which causes a missense mutation converting Leu to…
A: The mutation is simply defined as a process in which the sequence of DNA of any organism changes.…
Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…
A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…
Q: Neurospora crassa can synthesize the amino acid arginine from a precursor as follows: precursor…
A: It's an example of ONE GENE ONE ENZYME HYPOTHESIS By beadle and Tatum. Arginine is an alpha - amino…
Q: amino acid is acetylated when DNA is unwound from histones
A: The correct answer os option b).
Q: I have two proteins with 20 % sequence identity. I ask you if this is likely to be significant. What…
A: Proteins are polymers composed of monomer units known as amino acids. Proteins are complex molecules…
Q: what is the anticodon sequence that would build this protein?
A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…
Q: The mutation causing sickle-cell anemia in humans, which changes the normal T to an A in the sixth…
A: Hemoglobin is a normal globin protein with heme (iron) in the red blood cells. It helps to…
Q: Loss of the Sar1 guanine nucleotide exchange factor would influence all of the following EXCEPT:
A: Sar1 is a protein that acts as a GTPase associated with COP2 coated vesicles. These COP2 coated…
Q: Sickle cell disease results from a point mutation of the ______. α-globin of guanine for glutamine…
A: Sickle-cell disease: - RBC (Red blood cell) count decreases. - Anaemia condition
Q: 4. Figure shows a part of the sequence alignment of human and whale myoglobin proteins. Please…
A: Ans: Mutation: The change in the single nucleotide or multiple nucleotide which may results in loss…
Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…
A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…
Q: Determine the sequence of amino acids specified by the codons in the following information strand.…
A:
Q: Which of the following describe how the order of nucleotide bases along a gene in the DNA ultimately…
A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…
Shown in the following table are several amino acid substitutions
in the a and b chains of human hemoglobin. determine how many of them can occur as a result of a single
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following mutations would most likely keep the transitions of T state to R state in hemoglobin unchanged, or similar to the transitions that occur in the native molecule? The three-letter codes for amino acids are used, and the numbers following the amino acids designate the amino acid position in the protein. By convention, the original, native amino acid is listed fırst, followed by the mutational change. Choose one: O A. Asp94→Ile94 O B. Tyr42→Phe42 O C. Asp94 Glu94 O D. Tyr42-Gly42Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid is replaced by Valine. HBB sequence in normal adult hemoglobin (Hb A): Leu-Thr-Pro-Glu-Glu-Lys-Ser HBB sequence in mutant adult hemoglobin (Hb S): Leu-Thr-Pro-Val-Glu-Lys-Ser What effect does this mutation have on the structure and function of the protein? Predict what would happen to the RBC if the glutamic acid was replaced with asparagine instead of valine.if the B chain of human hemoglobin is 146 amino acids in length, calculate the minimum # of nucleotide base pairs needed to code for B-globin
- Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance. Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lysThe bacterially produced antibiotic gramicidin A forms channels in cell membranes that allow the free diff usion of Na+ and K+ ions, thereby killing the cell. This peptide consists of a sequence of Dand L-amino acids. The sequence of a segment of fi ve amino acids in gramicidin A is R-Gly-L-Ala-D-Leu-L-Ala-D-Val-R′. Complete the Fischer projection below by adding the correct group to each vertical bond.HbS results from the substitution of valine forglutamic acid at the number 6 position in the b chainof human hemoglobin. HbC is the result of a change atthe same position in the β chain, but in this case lysinereplaces glutamic acid. Return to the genetic code table and determine whether single-nucleotide changes can account for these mutations. Then view and examine the R groups in the amino acidsglutamic acid, valine, and lysine. Describe the chemicaldifferences between the three amino acids. Predict how thechanges might alter the structure of the molecule and leadto altered hemoglobin function.
- Amino acids project from each polypeptide backbone in a β-sheet in an alternating fashion (oneabove the plane and the next below the plane – see Fig 3.8B). Consider the following proteinsequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu.a. Is there a pattern to these amino acids? If so, what is it? b. What does this sequence of amino acids mean for the hydrophobicity/hydrophilicity of theresulting β-sheet? c. Can you make a prediction about how the β-sheet will be arranged in higher levels of protein structure? If so, what prediction would you make?Give the effect of the following changes in the protein structure of hemoglobin Replacement of analanine located at the middle of helix B with prolineThe genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
- Which amino acid pair constitutes the hydrophobic patch on sickle cell hemoglobin that results in formation of protein oligomers with the Glu 6 --> Val 6 sickle cell mutation? Does normal hemoglobin contain this same amino acid pair constituting a hydrophobic patch? Phe 85 / Leu 88; no Phe 85 / Leu 88; yes Trp 85 / Leu 88; yes Olle 85 / Leu 88; yes Pro 85 / Lys 88; noThe proximal histidine residues have been replaced by glycine residues by mutation of the cloned genes for both the α and β subunits of hemoglobin. With the tetrameric mutant hemoglobin (all subunits being mutant, α H F8 G, β H F8 G), it was found that the “proximal” coordination bonds to hemes in the mutant protein could be replaced by having the small molecule imidazole in the buffers. Oxygen binding curves for the tetrameric mutant hemoglobin were measured. A. The degree of cooperativity in oxygen binding for the mutant hemoglobin (with imidazole present) would be expected to 1) increase 2) decrease 3) not be affected) compared with the normal protein. B. Justify your answer to part A in terms of what you know about the structural basis of cooperativity in hemoglobin. C. How would the Hill coefficient for the mutant be expected to change compared with nH for normal hemoglobin, which is ~3?What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-