(a) How many exons does the gene contain? How many introns?(b) Where in this structure would you expect to find a 5',5'-internu-cleotide bond? Where would you expect to find a polyadenylic acidsequence? - Shown below is an R loop prepared for electron microscopy byannealing a purified eukaryotic messenger RNA with DNA from agenomic clone containing the full-length gene corresponding to themRNA.

mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…

Answered: (a) How many exons does the gene…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.
Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post here
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
In a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction may bedue to errors relating to omission of ingredients in the reaction mix and absence of the target sequence inthe template DNA. Based on (i) primer problem and (ii) purity/potential contamination of the target sequence, explain the reason for non-appereance on bands.
Imagine that you completed your ligation of the gRNA insert (annealed oligos) into cut PML104 vector and the ligation worked very well. When you transform your ligated plasmids into E. coli, which of the following would you expect to be translated? Select all that apply. BRNA NLS Ampicillin Cas9 None of the above Uracil synthesis protein O PML104 O beta-lactamase
Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.
Arrange the following list of eukaryotic gene elements in the order in which they would appear in thegenome and in the direction traveled by RNA polymerase along the gene. Assume the gene’s singleintron interrupts the open reading frame. Note thatsome of these names are abbreviated and thus do notdistinguish between elements in DNA versus RNA.For example, splice-donor site is an abbreviation forDNA sequences transcribed into the splice-donor sitebecause splicing takes place on the gene’s RNA transcript, not on the gene itself. Geneticists often usethis kind of shorthand for simplicity, even thoughit is imprecise. (a) splice-donor site; (b) 3′ UTR;(c) promoter; (d) stop codon; (e) nucleotide towhich methylated cap is added; (f) initiation codon;(g) transcription terminator; (h) splice-acceptorsite; (i) 5′ UTR; (j) poly-A addition site; (k) splicebranch site.
RNA polymeraze binds 100x quicker to the promotor when the promotor is in a 8kb plasmid than to the same promotor on a 200bp linear segment. Assuming that the incubation is performed with equal concentrations of the two types of DNA, explain this difference.
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the following sequences of a template : 3'-GGGCTATACCTGACCCTC-5'
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
given below is a small slice of a large sequence of protein taken from ORF1a polyprotein of Severe acute respiratory syndrome coronavirus 2 (isolate: wuhan-1). Convert the following sequence into protein strand using one letter code: 5'-ACCAACCAACTTTCGATCTCTTGTAGATCT-3'

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

SEE MORE TEXTBOOKS