Short notes about reproduction in the two main groups of eukaryotic micro-organisms.

Q: Answer the following about low carbohydrate diets: true/false Is made up of a large about of nonfat…

A: 1) A low carbohydrate diet is the one which includes the food items that contains a low amount of…

Q: Differentiate quantitative and qualitative types of variables or data, and explain their importance.…

A: •The quantitative data is made for collecting the numerical for use for measure data..  The…

Q: Describe how specific molecules are used to change the gene expression of a gene in a cell. Explain…

A:

Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…

A: RISA is the technique for microbial community analysis. It helps in determining the species…

Q: Q 5 - Another script was based on scenario 1. With an HIV prevalence of 0.1%. If an asymptomatic…

A: HIV prevelance 0.1% 68 year old man HIV positive

Q: The reason that why mycorrhizae might have been important in the colonization of terrestrial…

A: Mycorrhizae is a gerenally define that they are been symbiotic relationship between fungi and plant…

Q: Recent DNA evidence suggests to some plant taxonomists that the traditional way of classifying…

A: Recent DNA proof recommends to some established taxonomists that the conventional approach to…

Q: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately…

A: The translation is the process of producing protein mRNA as a template and peptidyl activity of the…

Q: 2.1. Distinguish anatomical differences between C3 and C4 plants.

A: C3 plants  Plants that use the C3 pathway or Calvin cycle for the dark reaction of photosynthesis.…

Q: Should one line of evidence hold more weight than another when we discuss the classification of…

A: Classification of species has made it possible to group species of plants, animals and…

Q: S1 heart sounds (“lub”) represent the closing of the

A: Heart is the main pumping orgen of circulatory system and vital organ of body. Contraction and…

Q: To explain: The evolutionary changes in the plant reproduction that are adapted by plants to…

A: The change of a species' defining feature over numerous generations is referred to as evolution,…

Q: Charles Darwin came up with several original ideas in his 1859 publication The Origin of Species.…

A: Charles Darwin propounded his fmous theory of natural selection which explains the process of…

Q: What sort of cellular changes would you expect a sailor sick with scurvy to experience? O Their…

A: Introduction: Vitamin C insufficiency is known as scurvy. Anemia, debility, tiredness,…

Q: Which of the following traits are unique to only Homo sapiens and not to Australopithecus or…

A: Australopithecus is a genus of early hominins that existed in Africa during the Late Pliocene and…

Q: Select the tool below that is not used for body composition measurement? Select one: O a.…

A: Body composition measurement is done by breaking down the human body into its individual components…

Q: When Mendel crossed in his P generation a yellow-seeded and green-seeded pea plants, all the…

A: As in F1 generation,all the pea plants have yellow seeds.This means that In pea plants,allele for…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Mutations are perpetual alterations in DNA that can command and change the expression of a gene.…

Q: 4. Describe the pathogenesis of patient's disorders in the pigment exchange. 5. What changes in…

A: Hepatitis happens when your liver becomes inflamed, often due to a viral infection. Alcohol…

Q: The mitral valve is located between the

A: The mitral valve or bicuspid valve is located between the left atrium and left ventricle.

Q: how do thermodynamics explain the ability of cells to do "metabolism" in general, or cellular…

A: Metabolism refers to the process through which the body converts food to energy to run vital…

Q: 56. A 42-year-old man who has angina pectoris comes to a physician who is an investigator in a…

A: Angina pectoris  A kind of pain in the chest which 8s develop due to insufficient flow of blood into…

Q: To test whether you understand the processes involved in the Central Dogma of       Molecular…

A: The synthesis of RNA from the DNA is known as transcription and they synthesis of protein from the…

Q: Research the behaviours of a specific ectothermic animal. How do specific behaviours allow for the…

A: Ectothermic animals, also called cold-blooded animals, rely on external sources of heat to maintain…

Q: One of the carbon atoms of a glucose molecule is [C14] - labeled. If 14CO₂ is released during the…

A: Glycolysis is the metabolic pathway that converts glucose, into pyruvic acid. The free energy…

Q: How does genetic therapy differ from traditional methods of treating a disease?   a. It targets the…

A: Gene therapy is the modern approach to treat a disease from the root of its occuarance. Traditional…

Q: 7 Use the following images to answer the next two questions. 5 6 Stage 8 in the diagram above is…

A: The given diagram illustrates cell division. There are two types of cell division - mitosis and…

Q: 33. Which of the following proteins facilitates the transport of neurotropic viruses to cell bodies…

A: The nervous system is made up of the brain, spinal cord, cranial nerves, and spinal nerves. It is…

Q: absence of a telomere?

A: Telomere is a specialized structure of eukaryotic chromosome that is present in a terminal region of…

Q: Write any two places where methanogens can be found.

A: Introduction: In oxygen-limited environments, methanogens are microbes that produce methane as just…

Q: uppose that in some plants, the molecule 2-carboxy-d-arabinitol 1-phosphate (CA1P) acts as a…

A: An enzyme is a protein with catalytic powers.

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Introduction Mutations are the alternation or changes that occur in the DNA. They are variations in…

Q: 19. A 22-year-old man who was recently diagnosed with type 1 diabetes mellitus has learned to test…

A: Diabetes 1 is a chronic disorder. Due to this disorder the patient pancreas produces little or no…

Q: The Atlantic cod population is of primary economic importance to fishing communities throughout the…

A: One potentially negative consequence of limiting the harp seal population.

Q: Why is Indole more likely to travel through the cell membrane than tryptophan? The image here shows…

A: Any molecule can transfer across a protein free lipid bilayer over a variable period of time due to…

Q: biology professor at a prestigious university stated to his introductory class that “Today, a basic…

A:

Q: Explain advantages of seeds in plants and enlist the process by which the plants that lack seeds…

A: Plants are eukaryotes that are multicellular and mostly photosynthetic. They are members of the…

Q: 47. Which of the following regions of the retina is capable of the highest spatial resolution and…

A: Introduction :- The retina connects the light that enters your eyes to the images that you see. Your…

Q: When working in forestry, knowledge of which of the following is considered essential? A. Astronomy…

A: Forestry is the process of growing trees as a renewable source for timber or biomass, decorative…

Q: the following statements best describes a relationship between the evolution of multicellular life…

A: First law of thermodynamics suggest that energy can be the be created nor destroyed though it can be…

Q: 50. A 23-year-old man is brought to the emergency department 1 hour after being injured in a hunting…

A: The boney skull forms the cranial end of the axial skeleton, formed by 22 bones (this is excluding…

Q: What data might make you conclude that the eukaryotes should be in more than one domain? What domain…

A: Eukaryotes are organisms that have nuclei or other organelles that are lattice. All animals, plants,…

Q: Modified TRUE or FALSE. Write T if the statement is completely TRUE and if false, change the…

A: Neurons are the functional units of the nervous system. The signals travel through the neurons in…

Q: A)Identify the bone B)What is the name given to area the arrow points to. C) Name one joint this…

A: The arms are the part of the skeleton, which include the bones of upper arm, firearm, wrist joints,…

Q: We can use the DCO class compared to the NCO (or parental) class (in a trihybrid cross) to…

A: The gene mapping used to compare the DCO (double crossover) class and NCO (non-crossover) class.

Q: Match the appropriate terms to their definitions TCA cycle or 4 tricarboxylic acid Choose.. cycle…

A: Question: Match the appropriate terms to their definitions Terms :  TCA cycle or tricarboxylic acid…

Q: 14. There are main food rich in carbohydrates that provides us energy. All of the following are…

A: Introduction  Carbohydrates, often known as sugar molecules, are sugar molecules. Carbohydrates are…

Q: Which of the following regarding statements Darwin and his theory of evolution is false? Darwin…

A: Darwin contributed to the science of evolution. Darwin established that current species of organisms…

Q: Describe Coronaviruses (genome, structure) .. describe a Coronavirus replication cycle.

A: Introduction :- Coronaviruses are a broad group of viruses that infect humans and cause mild to…

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: