[Select] [Select] [Select] transport. V transport. would move across a membrane using simple diffusion. would move across a membrane using primary active transport. would move across a membrane using secondary active ✓ [Select] Glucose (when blood glucose is high) Glucose (when blood glucose is low) Sodium ions Carbon dioxide [Select] nove across a membrane using simple diffusion. move across a membrane using primary active transport. would move across a membrane using secondary active
Q: Phosphoenolpyruvate (PEP) is converted to pyruvate by the enzyme pyruvate kinase. The standard free…
A: The standard free energy change (∆Gº') is the amount of energy released in of biochemical reaction…
Q: You want to study a biomolecule in the laboratory. You have ordered the synthetic gene from a…
A: The process by which a specific gene sequence of interest is ligated and then the newly synthesized…
Q: What amino acids are possibly present in each sample tests? Explain why.
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: 7. WHAT IS A PHOSPHODIESTER BOND? WHERE CAN IT BE FOUND? 8. GIVE AT LEAST 10 CARBOXYLIC ACIDS THAT…
A: Biomolecules are composed of monomeric units that are joined together through specific bonds.…
Q: The catalytic efficiency of many enzymes depends on pH. Chymotrypsin, which has a well-known…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: The Standard free energy CAG0¹) of the reaction shown above can be estimated based on? A. High…
A: Standard free energy of a reaction (∆Go') is the amount of energy released or consumed in the…
Q: The second step during elongation of fatty acid chain is catalyzed by B-ketoacyl reducatse. In which…
A: Simple fats or triglycerides or triacylglycerides are categorized as storage lipids. Triglycerides…
Q: Structure, localization and biological significance of glycogen.
A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…
Q: The following is a(n) [Select] [Select] V [Select] disaccharide with a(n) glycosidic bond.
A: Disaccharides are sugars which are formed as a glycosidic bond is formed between 2 monosaccharides.…
Q: A) List each of the five major functional classes of proteins. B) Discuss the function for each…
A: Amino acids are what makeup proteins. Protein structures are biopolymeric. Twenty amino acids are…
Q: Metabolic Integration Q9.1: Glucose-6-phosphate is a key metabolic intermediate in four major…
A: Glucose-6-phosphate is the key metabolic intermediate where it is branched to four major metabolic…
Q: COMPLETE ALL CALCULATIONS REQUIRED FOR TABLE 1 ( For all measurements, the [PNPP] concentration will…
A: P-Nitrophenyl phosphate Assay is an enzyme assay conducted for the enzyme alkaline or acid…
Q: EXPLAIN your choices for each of the following: a) The Hb variant least likely to cause…
A: In general, the quaternary structure of any protein is determined by the amino acids present in that…
Q: Vasopressin is a hormone that plays an important role in social behavior, sexual motivation, and…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and…
Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…
A: Protein structure: Each layer of a protein's structure, which includes multiple different layers,…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CACGGGG-3'
A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…
Q: 10) Determine bending rigidity of double stranded DNA molecule with persistence length of 45 nm (80%…
A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…
Q: Which of the following regarding the Electron Transport Chain is INCORRECT? It can accept electrons…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…
Q: The difference between purine and pyrimidine systhesis is: One builds the base on top of the sugar…
A: Among the nucleotides, adenine and guanine are purines. Cytosine and thymine are pyrimidines.…
Q: The structure of a metalloenzyme active site is down below(black picture). Describe, from a chemical…
A: Methane monooxygenase (MMO) is present in methanotrophic bacteria and MMO is present in an integral…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: Calculate and draw the isoelectric point of the tetrapeptide Ser-Leu-Phe-Pro at pH 7.0. hand written…
A: Isoelectric point is the pH at which the positive and negative charges are equal, i.e., the net…
Q: calculate the [PNP] in μM for each of these samples. For Table 2: Calculate the volumes of the 100…
A: 0.5mM =0.5 ×10-3 moles literi.e. 1 liter have 0.5 ×10-3 molesSo, 106 μL have 0.5 ×10-3 molesSo, 1…
Q: Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate using the enzyme…
A: The pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway…
Q: You are running a size exclusion column to purify your 25 kDa protein from a lysate mixture. The…
A: Size exclusion column chromatography: As a function of their respective sizes, molecules are…
Q: How are intracellular and extracellular proteins degraded?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: how did you get 0.03x10^-4? Also, what is the final answer?
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: What is the total number of moles of ATP generated per mole of glucose in the glycolytic pathway and…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: 3. Predict the effect of each of the following amino acid substitutions on the KM and keat of the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 1. Explain why lipids are insoluble in polar solvents. 2. How do oils and fats differ?
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: What test tube will show positive starch hydrolysis and negative starch hydrolysis?
A: Starch is the most common carbohydrates (polysaccharides) which is a polymer of several glucose…
Q: Please answer both of the following 1) The Haworth projection of D-altrose is shown What type of…
A: The cyclic structure of Glucose : The cyclic structure of furanose : The cyclic structure of…
Q: Question 5 An a-helix has the sequence: NH3-Ser-Glu-Gly-Asp-Trp-Gln-Leu-His-Val-Phe-Ala-Lys-Val-Glu-…
A: Alpha helix is a type of secondary structure of proteins. It is the rod-like structure formed when…
Q: Which of the following statements are true for enzymes? Check all that apply. The activity of some…
A: Enzymes catalyse biochemical reactions by decreasing the activation energy and increase the rate of…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: Using the results of linear regression analysis (log(MW, kDa) vs Rr) from the protein standards,…
A: Given that the linear regression analysis data of a plot of Log MW (in kDa) vs Rf is given as:…
Q: Name four amino acids that can be synthesized using pyruvate as a starting material. What one(s) of…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Sucrase has an optimum temperature of 37°C and an optimum pH of 6.2. Determine the effect of the…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: In beta-oxidation, which cofactor is required the for second oxidation reaction (conversion of…
A: Fatty acid β-oxidation is the metabolic process by which fatty acids are broken down to produce…
Q: De novo synthesis of nucleotides is an energy intensive process and therefore not always the…
A: Nucleotides are phosphorylated nucleosides. Phosphorylated nucleosides are known as nucleotides. A…
Q: Which of the following statements is correct regarding the structures below? CHO CHO но-н H H-OH ОН…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: Which is CORRECT for the flow of electrons from NADH? NADH Complex I→ ubiquinone → Complex III →…
A: The electrons from NADH is transferred via a series of complexes to synthesize ATP. This is known as…
Q: Which two statements below accurately describe the roles of insulin and glucagon in maintaining…
A: Glucagon is a hormone secreted by the pancreas that controls the blood glucose level. It prevents…
Q: Which of the following regarding the ATP Synthase is INCORRECT? Protons flow through the a and c…
A: ATP synthase, also called as Complex V is the protein complex responsible for synthesis of ATP from…
Q: Metabolic flux is regulated by both availability of substrates and level of enzyme activity. Match…
A: Enzymes are proteins which increase the rate of biochemical reactions. They carry out the quick…
Q: If the following oligosaccharide was treated with an enzyme that cleaved only a1,4 glycosidic bonds,…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Write a short description of the physical characteristics of acid & enzymatic hydrolysates. What…
A: Introduction: The principle of the benedict test is that when reducing sugars when heated in the…
Q: Aerobic glycolysis can produce ATP at a much faster rate than anaerobic oxidative phosphorylation.…
A: Pyruvate has a distinct outcome in anaerobic environments. Pyruvate is changed into lactate by the…
Q11
Step by step
Solved in 3 steps
- extracellular concentration time extracellular concentration While studying the rate of transport of a molecule into muscle cells, the above graphs were obtained. These graphs are consistent with which of the following transport mechanisms? Select all that apply. Active transport Facilitated Diffusion Transport via specific membrane proteins Simple Diffusion intracellular concentration transport rateHow is active transport different from simple diffusion? Both active transport and simple diffusion transport molecules against the concentration gradient. In active transport, molecules are moved down the concentration gradient; on the B contrary, molecules to be transported in simple diffusion are moved against the concentration gradient. In active transport, molecules are transported with the aid of transport proteins; on the © other hand, molecules to be transported in simple diffusion do not need transport proteins. In active transport, molecules that are transported does not need metabolic energy; in contrast, molecules transported in simple diffusion need metabolic energy.Determine the type of transport. Here are your options:Simple diffusion, facilitated diffusion, osmosis, primary activetransport, secondary active transport1. A hydrophobic molecule is moving through the membrane2. K+ moving against its gradient (low to high) through the sodiumpotassium pump3. Water moving through the cell membrane4. A solute moving down its gradient through a carrier protein
- The comparison of the simple diffusion, facilitated diffusion and active transport are shown in the table below: * Which comparisons are TRUE? Simple Diffusion Facilitated Diffusion Active Transport I Require ATP Does not require ATP Require ATP II Does not involve a Involve a transport Involve a transport transport protein protein protein From a region of higher III From a region of higher concentrațion of substance to a region of lower concentration of From a region of lower concentration of concentration of substance to a region of lower concentration of substance. substance to a region of higher concentration of substance. substance. O I and II only I and III only O Il and III only O I, Il and IIIIn Chapters 11 & 12, the following examples of membrane transport proteins are given. Fill out the table with the correct answer for that particular transport protein. Type of transport protein (channel or carrier/transporter?) K* leak channel glucose transporter bacteriorhodopsin Na-K pump glucose-Na symport Na-H exchanger Performs active or passive transport? Energy source for movement of solute(s) or ion(s) Direction of movement of solute(s) or ion(s) with respect to the electrochemical gradient Na K* Na glucose Na H' Direction of movement of solute(s) or ion(s) with respect to the membrane crossed Na K₁ Na' glucose Na H' Is the protein a uniport, symport, antiport, or none of the above?B) Rate of transport into the cll A or B 10 20 30 40 Time (min) The graph directly above shows the rate of substance transport over time when the cells that do not contain the compounds A, B, or C, are placed in 1 mM solutions of A, B, and C, respectively. Based upon these data which of the following is/are compatible modes of transport for substance A? (active transport, facilitated diffusion, simple diffusion) For substance B? For substance C?
- [Low Glucose (Low Amino Acid) High Na Inside cells: THigh Glucose [High Amine Acid) Low Na) ER Nucleus Nule Blood vessel N Pump Neuoe te franperer Glucose Caer NAA Ce-apote Amine Acid Carier Secondary Primary active transport Facilitated active transport Diffusion In which direction would you expect Amino Acids to flow based on this diagram? OLumen of small intestine --> Inside small intestine cells- Blood vessel Lumen of small intestine Inside small intestine cells Blood vessel Small intestine cells -Lumen of small intestine Blood vessel Jr D00 44 20 F3 F1 F2 %23 2 3 5 7 8 * CO 248. Define homeostasis. maintoining nterral balance 9. What role does the cell membrane play in maintaining homeostasis? 10. How is facilitated diffusion different from diffusion? How are they similar? 11. List two ways that active transport is different than passive transport. 1) 2) 12. Why is the sodium-potassium pump considered an active transport? Which direction are the sodium and potassium bing pumped? How many sodiums are being pumped? How many potassiums are being pumped?rate of transport Vmax 1/2Vmax transporter-mecated diffusion Km simple diffusion concentration of transported molecule The graph at left shows rates of movement across a cell membrane for a substance that uses simple diffusion (green) and a transport mechanism (red). Which of the following is TRUE about the transporters at the point shown by the arrow? A. The transporter proteins are operating more slowly than at lower concentrations. B. The transporter proteins are operating as fast as possible. C. The transporters proteins shut off at that concentration. D. The rate slows because transporter proteins run out of ATP.
- For this practice problem, would the answer be c)NaCl? My reasoning behind this is because molecules under 100 Da can use simple diffusion, while nonpolar molecules and larger molecules like benzene can use channels via facilitated diffusion. However, NaCl dissociates into ions and cannot readily use diffusion?Cold HOT Effect of Temperature on the Rate of Diffusion Solutes move within a cell's cytoplasm largely because of diffusion. However, the rate of diffusion is affected by such factors as temperature and the size of the solute molecule. Observe the effect of different temperatures on the rate of diffusion by watching the video above. Temperature Homework • Unanswered At which temperature did solutes dissolve the fastest? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a At hot temperatures E Fullscreen b At cold temperaturesMatch the following statement related to membrane transport processes to the appropriate term or terms: passive transport, facilitated transport, active transport. A transporter (or carrier) protein is necessary. (Select all that apply.) passive transport facilitated transport active transport O O