Select five (5) different isolated colonies in the illustration below and fully characterize each of them by describing their texture, transparency, color, and form (size, overall shape, margin, and elevation). Crop each colony you have chosen and tabularize your answer
Q: 1. What is diversity? 2. Differentiate between predation and herbivory. 3. List and give examples of…
A: Ecology is the study of interactions between living things, such as humans, and their natural…
Q: Wings enable insects to utilize diverse resources disperse more widely than any other land…
A: Invertebrates belonging to the phylum Arthropoda are classified as insects. With over a million…
Q: Provide significant recordings/finding that can be observed on the said structures that can be…
A: A slit lamp is a medical device used for examining the eye's anterior segment structures, including…
Q: Now, this variation is not within the gene itself. It's outside the gene. In fact, it's upstream of…
A: Changes outside the gene means that these changes may alter the DNA sequence and such changes may be…
Q: Why does the food industry continue to investigate new methods of food preservation? What is the…
A: Food preservation involves preventing the growth of microorganisms that lead to contamination and…
Q: outline and describe the impact of Charles Lyell's work on the development of Charles Darwin's…
A: Charles Lyell was a geologist and a contemporary of Charles Darwin whose work on geology had a…
Q: How many pigeons are in the population?
A: To assess the population size of a particular species, two major approaches are used by the…
Q: Efforts to produce an HIV vaccine have met with limited success. What aspects of the virus and its…
A: The question is about the challenges in developing a vaccine against HIV and what aspects of the…
Q: A Pituitary gland s and muscles O: B Mammary glands www.w C Testes or ovaries D Releasing hormones…
A: A= Growth hormone is produced by our brain's pituitary gland and governs our height, bone length…
Q: Question 6. What are the first three amino acids in the protein that is produced from this gene?…
A: Genetic code exists in the form of codons and these codons are the sets of three nucleotides. There…
Q: /2 Actor = 0.00 r = 0.25 -0.50 =1.00 1/2 1/2 1/2 Recipient
A: According to Hamilton's rule of kin selection. Br - c>0 Where B is the benefit to the relative…
Q: According to the intermediate disturbance hypothesis _____________________. Question 22 options:…
A: Disturbance is defined as the process that eliminates species from the community over a period of…
Q: With pulmonary vasoconstriction resulting from increased alveolar carbon dioxide what will haopen to…
A: Blood is transported from the right ventricle of the heart to the lungs and then back to the left…
Q: 10. X X **8457227
A: The inbreeding coefficient calculates the probability that a person will receive two duplicate…
Q: 11. What is the GO phase of the cell cycle? Which factors determine whether a cell enters GO? Can…
A: The eukaryotic cell cycle is a complex process by which eukaryotic cells reproduce and divide. It…
Q: What usually initiates acute appendicitis? Select one: A. Eating a low-fiber diet B. Malnutrition C.…
A: Acute appendicitis is a common medical emergency that occurs when the appendix, a small,…
Q: 31. Acetylcholine: a) Is blocked by Propranolol b) Is blocked by curare in the autonomic ganglion c)…
A: Otto Loewi originally referred acetylcholine the first neurotransmitter identified as "vagus stuff"…
Q: If from Family B, Generation V, Individual 5 were to get married to a heterozygous male, what would…
A: In the given case, the genotype of female is "ll" (lactose intolerant) and the genotype of male is…
Q: Which statement about growth spurts in adolescence is true? Growth spurts end by age 16 for both…
A: Short-lived times of rapid physical growth in the child's height and weight are known as growth…
Q: How is molecule 3 Reverse transcriptase? Isn't that an enzyme and not a molecule nor product? The…
A: The given question is related to RT-PCR. RT-PCR stands for Reverse Transcription Polymerase Chain…
Q: 9) The the function. and the of amino acids determine the shape of proteins, while the a. property,…
A: Proteins are vast and complex molecules that are required for the normal functioning of living…
Q: In the context of brain development, why can social interactions be difficult for adolescents? They…
A: ANSWER) Adolescents, also known as teenagers, are individuals who are in the transitional stage…
Q: 10. Describe the steps necessary for geographic isolation to lead to speciation. 11. Identify and…
A: The prevention of mating among interbreeding groups due to physical and biotic barriers is termed as…
Q: 2. What do you predict might happen to the cells of a fish that is accustomed to living in fresh…
A: Osmosis is the movement of water molecules across a selectively permeable membrane from an area of…
Q: H. Pylori 1. which one is the most effective treatment and how effective are the other options? 2.…
A: *NOTE: Kindly repost for other questions* Dear Student as per the guidelines we are supposed to…
Q: 1.What difficulties does one encounter when trying to differentiate bacteria on the basis of…
A: The catalase test is useful for differentiating staphylococci from streptococci because these two…
Q: 6) The autoclave desired Temperature to kill bacterial spores must be left for at least ____ in…
A: An autoclave is a device used in laboratory and medical settings to sterilize equipment, materials,…
Q: The only winged invertebrates are from which group? Hymenoptera arachnids crustaceans insects O…
A: Invertebrates are animals that lack a spinal column or vertebral column. They make up the great…
Q: Question 2. From mouse nerve cells you isolate the mouse Tau-gene-containing DNA fragment and…
A: The tau gene is a gene that encodes the Tau protein, which is predominantly expressed in neurons in…
Q: While many of the following parameters may change, which one of the following is the most definitive…
A: Emphysema is a chronic obstructive pulmonary disease that causes damage to the air sacs and airways…
Q: what tests can you run doebthe diagnosis of Salmella typhi, and what is progression of the disease,…
A: The diagnosis of Salmonella typhi infection also known as typhoid fever can be made through several…
Q: how does administration of 100% oxygen save a patient from carbon monoxide poisioning
A: Carbon Monoxide(CO) Poisoning happens when the concentration of carbon monoxide increases in blood…
Q: 5. NADH and FADH2 are electron carrier molecules which yield 2.5 and 1.5 ATP molecules.
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 19) The base pairs of a DNA molecule are held together by which of the following? a. hydrogen bonds…
A: DNA acts as a genetic material in almost all living organism. DNA is composed of nitrogenous bases…
Q: In the fruit fly Drosophila melanogaster, the trait of black body is due to a gene on chromosome 2…
A: To determine the recombination frequency and genetic map distance between the two genes, we need to…
Q: 38) The following treatment(s) control bacterial growth by damaging the DNA structure of bacteria:…
A: Understanding the development and survival of microorganisms is one of the most fundamental aspects…
Q: What factors dictate ecological footprint? Mention three of them, that can improve ecological foot…
A: Environmental sustainability is a increasingly important issue nowadays, as we face range of…
Q: 5' AAGACCTATATAATGACGAACGATATT 3 TTCTGGATATATTACTGCTTGCTATAA 5¹ Coding strand: Template strand: 3'
A: Untranslated regions (UTRs) are extra sequences found in mRNA that are not translated. UTRs include…
Q: When does physical activity begin to decline for children? at around age 10 at around age 7 at…
A: Physical activity is essential for children's growth and development. It helps maintain healthy…
Q: if the ventricle cannot pump out as much blood to lung as is coming in through the vena cava what…
A: Venous return refers to the volume of blood that flows from the systemic circulation back to the…
Q: The inner nuclear membrane contains a) None of these choices are accurate b) proteins…
A: The nuclear membrane is a defining feature of the eukaryotic cell. It is a phospholipid double…
Q: Provide an example of a passive immunity created artificially. How does the vaccinated person gain…
A: Artificial passive immunity is a form of immunization that involves the administration of pre-formed…
Q: Question 4 Which of the following information molecules is double-stranded? O deoxyribonucleic acid…
A: Genetic material is the component of a cell that contains the genetic information that can be passed…
Q: figured out that the protein sequence was: Met-Ala-Arg-Gly-Trp-Ala-Pro Work backwards…
A: In this process first of all RNA sequence could be find out by the genetic code. Later on sequences…
Q: A. Determine the genotype of the gametes that will come from parent 1 and parent Then, perform a…
A: When both parents have the same genotype, in this case, Tt, there are two possible gametes that each…
Q: 15. The termination of acetylcholine action is mainly due to: a) Reuptake by preganglionic neurons…
A: The neurotransmitter acetylcholine plays a variety of roles in the neurological system. It is a…
Q: The achoo syndrome (sneezing in response to bright light) is a dominant trait in humans. Two adults…
A: A Punnett square is a tool used in genetics to predict the potential offspring of a cross between…
Q: a) Fluorescent probes such as DAPI are often used to study cells that are in the different phases of…
A: DAPI( 4′,6-diamidino-2-phenylindole) is used as nuclear counterstain when fluorescence activated…
Q: 1. What is a true pathogen and who does it typically infect? What is an opportunistic pathogen and…
A: True pathogens are capable of causing disease in healthy individuals with a functional immune…
Q: Click on the purple section labeled "Cell Cycle Phases" as well as the words "Mitosis" and…
A: Basically cell cycle is the whole process by which a cell devides into two daughter cells. Cell…
Select five (5) different isolated colonies in the illustration below and fully characterize each
of them by describing their texture, transparency, color, and form (size, overall shape, margin, and elevation). Crop each colony you have chosen and tabularize your answer.
Step by step
Solved in 3 steps with 1 images
- Identify the texture, transparency, color, colony size, form, margin and elevation of the two colonies in the photo (a) and (b)Describe the results for each test indicated below. Use full sentences and write your answers in proper paragraph form. Gram stain Positive or Negative (How did you know?) Cell arrangement Cell morpholog Phenol Red Fermentation Did fermentation occur in each sugar? What products were produced? (How could you tell?) Streak for Isolation Successful or unsuccessful? (How could you tell?) Pigmented or non-pigmented? describe any other characteristics of Colony MorphologyDraw a 4-inch circle. Draw out the streaking pattern used to isolate single colonies on a plate.
- You have identified two colony types A and B on the streak plate. Now briefly describe (in 3-4 sentences) the process of how you identified the cellular morphology/arrangement of each isolate. Again, assume you have all the necessary equipment and materials at your disposal. Be concise and thorough, not verbose; e.g., refer to the Gram stain, but describing the details of each step is not necessary. Following the description, provide the cell morphology information for each isolate. Isolate A – Describe: Cellular morphology & arrangement: Gram stain color & result: Isolate B – Describe: Cellular morphology & arrangement: Gram stain color & result:Using the image below, select the best descriptor for the following: Colony shape: round Colony margin: entireNegative Stain (list color of organism stained with negative stain) - Capsule Stain (list color and example of organism with capsule) - Spore stain (list color and example of spore and cell) * Previous
- Write the name of the lab specimen which is a corn ?You have identified two colony types A and B on the streak plate. Now briefly describe (in 3-4 sentences) the process of how you identified the cellular morphology/arrangement of each isolate. Again, assume you have all the necessary equipment and materials at your disposal. Be concise and thorough, not verbose; e.g., refer to the Gram stain, but describing the details of each step is not necessary.When analyzing your results after performing a serial dilution, you obtain an average of 40 colonies on your 1 x 106 plate. How many cells were in the original sample?
- The actual length of a cell is 50µm. When projected on the big screen in the class, the same cell is 2m long. What is the magnification factor of the cell on the screen? 1 000x 4 000x 10 000x 40 000x 100 000x 400 000xYou have 1 ml of kombucha. You remove 0.1 ml of this and mix it with 9.9 ml of fresh tea. You mix the second tube, then remove 1 ml of this mixture and add it to 9 ml of fresh tea. You then mix this, and remove 0.1 ml of this solution, and plate it. The next day, you return to find 362 colonies. What was the concentration of the cells in the original mix? Show your calculations. My professor worked this problem out in class but she used a different method than that from the Khan academy videos on youtube and I am getting lost in the steps. Do you mind labeling?Below are the ingredients of a heirloom recipe of Ana's family. Identify the organisms for each of the heirloom recipe ingredients? Ingredient - Organism 1.Beef- 2. Carrots- 3. Sweet potato- 4. Garlic- 5. Onion- 6. Peppers- 7. Tomato paste- 8. Liver spread - 9. peppers- 10. Cheese- 11. Milk- 12. Soy sauce- 13. Oil- 14. Salt-